| OD2772 |
C. elegans |
ltSi914 II; unc-119(ed3) III. Show Description
ltSi914 [osm-6p::vhhGFP4::zif-1::operon-linker::mCherry::his-11::tbb-2 3'UTR + Cbr-unc-119(+)] II. This transgenic strain mediates sensory neuron-specific degradation of GFP-tagged proteins; can be combined with endogenous locus GFP-tagging or rescue of a null mutant with a GFP fusion to examine sensory neuron-specific functions of target genes. Reference: Wang S, et al. Development. 2017 Jun 15. pii: dev.150094. doi: 10.1242/dev.150094.
|
|
| OD2773 |
C. elegans |
ltSi915 II; unc-119(ed3) III. Show Description
ltSi915 [osm-6p::zif-1::operon-linker::mCherry::histone::tbb-2 3'UTR + Cbr-unc-119(+)] II. Control strain for OD2772, which mediates ciliated sensory neuron-specific degradation of GFP-tagged proteins. Superficially wild type. Reference: Wang S, et al. Development. 2017 Jun 15. pii: dev.150094. doi: 10.1242/dev.150094.
|
|
| OD2984 |
C. elegans |
ltSi953 II; unc-119(ed3) III. Show Description
ltSi953 [mec-18p::vhhGFP4::zif-1::operon-linker::mKate::tbb-2 3'UTR + Cbr-unc-119(+)] II. This transgenic strain mediates touch neuron-specific degradation of GFP-tagged proteins; can be combined with endogenous locus GFP-tagging or rescue of a null mutant with a GFP fusion to examine touch neuron-specific functions of target genes. Reference: Wang S, et al. http://biorxiv.org/content/early/2017/01/30/104398
|
|
| OD4235 |
C elegans |
ltSi220 I; ltSi1129 II; unc-119(ed3) III. Show Description
ltSi220 [mex-5p::GFP::tbb-2::operon-linker::mCherry::his-11 + Cbr-unc-119(+)] I. ltSi1129 [spd-2p::spd-5(re-encoded) + Cbr-unc-119(+)] II.
Re-encoded spd-5 is siRNA-resistant. mCherry-labeled histones. GFP-labeled microtubules. Reference: Ohta M, et al. J Cell Biol. 2021 Feb 1;220(2):e202009083. doi: 10.1083/jcb.202009083. PMID: 33399854.
|
|
| OD4313 |
C elegans |
ltSi220 I; ltSi1219 II; unc-119(ed3) III. Show Description
ltSi220 [mex-5p::GFP::tbb-2::operon-linker::mCherry::his-11 + Cbr-unc-119(+)] I. ltSi1219 [spd-2p::spd-5(S653A S658A)::spd-5 3'UTR + Cbr-unc-119(+)] II. Small centrosomes. mCherry-labeled histones. GFP-labeled microtubules. Reference: Ohta M, et al. J Cell Biol. 2021 Feb 1;220(2):e202009083. doi: 10.1083/jcb.202009083. PMID: 33399854.
|
|
| OD4467 |
C elegans |
ltSi220 I; ltSi1232 II; unc-119(ed3) III. Show Description
ltSi220 [mex-5p::GFP::tbb-2::operon-linker::mCherry::his-11 + Cbr-unc-119(+)] I. ltSi1232 [spd-2p::spd-5(S170A T178A T198A)::spd-5 3'UTR + Cbr-unc-119(+)] II. mCherry-labeled histones. GFP-labeled microtubules. Reference: Ohta M, et al. J Cell Biol. 2021 Feb 1;220(2):e202009083. doi: 10.1083/jcb.202009083. PMID: 33399854.
|
|
| OD4833 |
C elegans |
ltSi220 I; ltSi1561 II; unc-119(ed3) III. Show Description
ltSi220 [mex-5p::GFP::tbb-2::operon-linker::mCherry::his-11 + Cbr-unc-119(+)] I. ltSi1561 [spd-2p::spd-5(S170A T178A T198A S653A S658A)::spd-5 3'UTR + Cbr-unc-119(+)] II. mCherry-labeled histones. GFP-labeled microtubules. Reference: Ohta M, et al. J Cell Biol. 2021 Feb 1;220(2):e202009083. doi: 10.1083/jcb.202009083. PMID: 33399854.
|
|
| OH14125 |
C. elegans |
daf-16(ot853[daf-16::linker::mNeonGreen::3xFlag::AID]) I. Show Description
mNeonGreen tag inserted into endogenous daf-16 locus; AID at 3' end of mNeonGreen. Transgene can be degraded in a background expressing TIR1 co-factor and supplemented with auxin, allowing conditional knock-down of daf-16 expression. Reference: Bhattacharya et al. Cell. 2019 Feb 21;176(5):1174-1189.e16. PMID: 30686580
|
|
| OH16047 |
C. elegans |
eat-5(ot980[eat-5::GFP]) I. Show Description
GFP tag with 6x GS linker inserted at C-terminus of endogenous eat-5 locus.
|
|
| OS12700 |
C. elegans |
unc-30(ns959[unc-30::GFP::degron]) IV. Show Description
Linker with GFP tag and degron inserted at the C terminus of the endogenous unc-30 locus. GFP expression in ASG, AVJ, DD, VD, and PVP neurons and GLR glia. Reference: Stefanakis N, et al. 2024 Feb 15. doi: 10.1038/s44318-024-00049-w. PMID: 38360995.
|
|
| OS13288 |
C. elegans |
let-381(ns995[let-381::gfp::degron]) I. Show Description
Linker with GFP tag and degron inserted at the C terminus of the endogenous let-381 locus. GFP expression in GLR glia, HMC and coelomocytes. Reference: Stefanakis N, et al. 2024 Feb 15. doi: 10.1038/s44318-024-00049-w. PMID: 38360995.
|
|
| PHX1433 |
C elegans |
flp-11(syb1433[flp-11::SL2::egl-23(cDNA)(A383V)::linker::mKate2]) X. Show Description
egl-23 cDNA(A383V) was knocked into the endogenous locus of flp-11 to express a potassium channel in RIS that causes moderate inactivation of RIS. Reference: Busack I & Bringmann H. PLOS Genetics 19(3): e1010665. https://doi.org/10.1371/journal.pgen.1010665.
|
|
| PHX1464 |
C elegans |
flp-11(syb1464[flp-11::SL2::egl-23(cDNA)(L229N)::linker::mKate2]) X. Show Description
egl-23 cDNA(L229N) was knocked into the endogenous locus of flp-11 to express a potassium channel in RIS that causes strong inactivation of RIS. Reference: Busack I & Bringmann H. PLOS Genetics 19(3): e1010665. https://doi.org/10.1371/journal.pgen.1010665.
|
|
| PHX2193 |
C elegans |
flp-11(syb2193[flp-11::SL2::mKate2::linker::twk-18(e1913)]) X. Show Description
twk-18(e1913) was knocked into the endogenous locus of flp-11 to express a potassium channel in RIS that causes very strong inactivation of RIS. Reference: Busack I & Bringmann H. PLOS Genetics 19(3): e1010665. https://doi.org/10.1371/journal.pgen.1010665.
|
|
| PHX2493 |
C elegans |
lgc-38(syb2346[flp-11p::dpy-10 site::flp-11 3UTR] syb2493[ReaChR::linker::mKate2]) III. Show Description
ReaChR expressed in RIS for optogenetic activation. Reference: Busack I & Bringmann H. PLOS Genetics 19(3): e1010665. https://doi.org/10.1371/journal.pgen.1010665.
|
|
| PHX3190 |
C elegans |
lgc-38(syb2346[flp-11p::dpy-10 site::flp-11 3UTR] syb3190[unc-58(e665)::linker(GSGSGSGSG)::mKate2]) III. Show Description
flp-11p::unc-58(e665) was knocked into a SKI LODGE site to express a sodium channel in RIS that causes moderate over activation of RIS. Reference: Busack I & Bringmann H. PLOS Genetics 19(3): e1010665. https://doi.org/10.1371/journal.pgen.1010665.
|
|
| PHX5791 |
C. elegans |
pop-1(syb5791[GFP::AID::GGGGSGSGS linker::pop-1]) I. Show Description
GFP and AID tags inserted at the N-terminus of the endogenous pop-1 locus by CRISPR. Insertion includes a GGGGSGSGS linker sequence between the tags and POP-1. Generated in N2 background.
|
|
| PHX7768 |
C. elegans |
tdc-1(syb7768[GFP::linker::H2B::T2A::tdc-1]) II. Show Description
Endogenous tdc-1 locus tagged by CRISPR/Cas9-engineering. Reference: Wang C, et al. bioRxiv 2023.12.24.573258; doi: https://doi.org/10.1101/2023.12.24.573258.
|
|
| VT3751 |
C. elegans |
maIs105 V; hbl-1(ma430[hbl-1::mScarlet-I]) X. Show Description
maIs105 [col-19::GFP] V. hbl-1(ma430) is a CRISPR/Cas9-edited allele, which contains a linker and the mScarlet-I sequence integrated in-frame with hbl-1. Reference: Ilbay O & Ambros V. Curr Biol. 2019 Jun 3;29(11):1735-1745.e4.
|
|
| VT3869 |
C. elegans |
wIs51 V; hbl-1(ma430ma475[hbl-1::mScarlet-I::partial deletion of hbl-1 3'UTR]) X Show Description
wIs51 [SCMp::GFP + unc-119(+)] V. GFP expression in seam cells. Retarded Heterochronic defects: extra seam cells and partial or no alae in young adults. hbl-1(ma430ma475) is a CRISPR/Cas9-edited allele, which contains a linker and the mScarlet-I sequence integrated in-frame with hbl-1 and part of the 3' UTR removed. Reference: Ilbay O & Ambros V. Development. 2019 Nov 6;146(21).
|
|
| VT3922 |
C. elegans |
lin-28(n719) I; daf-12(ma497[daf-12::gfp]) hbl-1(ma430[hbl-1::mScarlet-I]) X. Show Description
Precocious heterochronic phenotypes as preciously reported for lin-28(n719). Endogenous daf-12 locus tagged with GFP. hbl-1(ma430) is a CRISPR/Cas9-edited allele, which contains a linker and the mScarlet-I sequence integrated in-frame with hbl-1. Reference: Ilbay O & Ambros V. Development. 2019 Nov 6;146(21).
|
|
| ZT22 |
C. elegans |
fjSi1 II; csr-1(fj54) IV. Show Description
fjSi1 [2×FLAG::csr-1 + Cbr-unc-119(+)] II. Single-copy insertion in the MosSCI locus ttTi5605 (LG II). The 2×FLAG::csr-1 transgene was designed to express proteins with a double FLAG tag instead of the N169 of CSR-1a and N6 of CSR-1b. The linker sequence between the two FLAG tags has a NotI site. The insertion can be checked by PCR with the following primers: CACACTCGATTCTACGCCAA (at the 3'-side of csr-1) and ATCGGGAGGCGAACCTAACTG (near ttTi5605 on LG II). Reference: Tabara H, et al. (2023) A small RNA system ensures accurate homologous pairing and unpaired silencing of meiotic chromosomes. EMBO J, e105002.
|
|
| ZT24 |
C. elegans |
vsra-1(tm1637) I; fjSi3 II. Show Description
fjSi3 [HA_2×FLAG::C04F12.1 + Cbr-unc-119(+)] II. Single-copy insertion in the MosSCI locus ttTi5605 (LG II). The HA_2×FLAG::C04F12.1 transgene was designed to express a protein with an HA tag and a double FLAG tag inserted after S21 of C04F12.1. The linker sequence between the HA tag and the double FLAG tag has a NotI site. The insertion can be checked by PCR with the following primers: GGAGCCGATTTGTTCCAGTC (at the 3'-side of C04F12.1) and ATCGGGAGGCGAACCTAACTG (near ttTi5605 on LG II). vsra-1 is also known as csr-2/C04F12.1. Reference: Tabara H, et al. (2023) A small RNA system ensures accurate homologous pairing and unpaired silencing of meiotic chromosomes. EMBO J, e105002.
|
|
| ZT56 |
C. elegans |
fjSi19 II; unc-119(ed3) III. Show Description
fjSi19 [rpl-21p::2×HA::C04F12.1 + Cbr-unc-119(+)] II. Single-copy insertion in the MosSCI locus ttTi5605 (LG II). The 2×HA::C04F12.1 transgene was designed to express a protein with a double HA tag at its N-terminus, using a strong ubiquitous promoter (rpl-21p). The linker sequence between the two HA tags has a NotI site. The insertion can be checked by PCR with the following primers: GGAGCCGATTTGTTCCAGTC (at the 3'-side of C04F12.1) and ATCGGGAGGCGAACCTAACTG (near ttTi5605 on LG II). vsra-1 is also known as csr-2/C04F12.1. Reference: Tabara H, et al. (2023) A small RNA system ensures accurate homologous pairing and unpaired silencing of meiotic chromosomes. EMBO J, e105002.
|
|