More Fields
Strain Species Genotype
AX2157 C. elegans tax-2(p694) I; lin-15B&lin-15A(n765) X; dbEx722. Show Description
dbEx722 [flp-17p::tax-2(cDNA)::SL2::GFP + lin-15(+)]. Pick non-Muv to maintain. Array rescues tax-2 in BAG. Reference: Bretscher AJ, et al. Neuron. 2011 Mar 24;69(6):1099-113.
AX2159 C. elegans tax-2(p694) I; lin-15B&lin-15A(n765) X; dbEx723. Show Description
dbEx723 [gcy-32p::tax-2(cDNA)::SL2::GFP + lin-15(+)]. Pick non-Muv to maintain. Array rescues tax-2 in AQR, PQR, and URX. Reference: Bretscher AJ, et al. Neuron. 2011 Mar 24;69(6):1099-113.
AX2161 C. elegans tax-2(p694) I; lin-15B&lin-15A(n765) X; dbEx724. Show Description
dbEx724 [flp-6p::tax-2(cDNA)::SL2::GFP + lin-15(+)]. Pick non-Muv to maintain. Array rescues tax-2 in ASE using an ASE-specific flp-6p fragment. Reference: Bretscher AJ, et al. Neuron. 2011 Mar 24;69(6):1099-113.
AX2164 C. elegans tax-2(p694) I; lin-15B&lin-15A(n765) X; dbEx725. Show Description
dbEx725 [gcy-8p::tax-2(cDNA)::SL2::GFP + gcy-32p::tax-2(cDNA)::SL2::GFP+ flp-17p::tax-2(cDNA)::SL2::GFP + flp-6p::tax-2(cDNA)::SL2::GFP + lin-15(+)]. Pick non-Muv to maintain. Array rescues tax-2 in AFD, AQR, PQR, URX, BAG, and ASE. Reference: Bretscher AJ, et al. Neuron. 2011 Mar 24;69(6):1099-113.
AX2178 C. elegans tax-2(p694) I; lin-15B&lin-15A(n765) X; dbEx726. Show Description
dbEx726 [gcy-8p::tax-2(cDNA)::SL2::GFP + lin-15(+)]. Pick non-Muv to maintain. Array rescues tax-2 in AFD. Reference: Bretscher AJ, et al. Neuron. 2011 Mar 24;69(6):1099-113.
AX301 C. elegans npr-1(ad609) lin-15B&lin-15A(n765) X; dbEx35. Show Description
dbEx35 [npr-1::GFP + lin-15(+)]. Pick Non-Muv to maintain. Solitary feeders. GFP is expressed in approximately 20 neuron types. Reference: Coates JC, de Bono M. 2002 Nature 419: 925-929.
BXN653 C. elegans scrm-1(cjn26) zdIs5 I. Show Description
zdIs5 [mec-4p::GFP + lin-15(+)] I. mec-4::GFP is expressed in touch neurons. Null allele of scrm-1: 2501 bp deletion and 7 bp insertion (CACACAT) removes the entire scrm-1 coding sequence (position 11688933 - 11691433 of chromosome I).
CF1192 C. elegans egl-27(n170) II; muIs35 V. Show Description
muIs35 [mec-7::GFP + lin-15(+)].
CF1259 C. elegans mig-13(mu225) lin-15B&lin-15A(n765) X; muIs62. Show Description
muIs62 [mig-13p::mig-13::GFP + lin-15(+)].
CF1632 C. elegans unc-62(mu232) muIs35 V. Show Description
muIs35 [mec-7::GFP + lin-15(+)]. Egl. GFP+. QR pax migration defect.
CF1665 C. elegans muIs32 II; mig-15(mu327) X. Show Description
muIs32 [mec-7p::GFP + lin-15(+)]. QL descendants migrate anteriorly; defects in HSN migration, male tail formation and PLM axon outgrowth. Egl. Unc. Pvl. Weak Dpy.
CF1756 C. elegans ptp-3(mu245) muIs32 II. Show Description
muIs32 [mec-7p::GFP + lin-15(+)]. QL descendants migrate anteriorly.
CF702 C. elegans muIs32 II. Show Description
muIs32 [mec-7p::GFP + lin-15(+)]. Superficially wild-type. Reference: Ch'ng, Q et al. (2003) Geneteics 164:1355-67.
CX188 C. elegans dig-1(ky188) III; kyIs4 X. Show Description
kyIs4 [ceh-23p::unc-76::GFP + lin-15(+)] X. kyIs4 contains a fragment of unc-76 protein that drives enrichment of GFP in the axons. Posteriorly displaced nerve ring axons. This strain may contain lin-15(n765) X. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
CX2565 C. elegans kyIs4 lin-15B&lin-15A(n765) X. Show Description
kyIs4 [ceh-23p::unc-76::GFP + lin-15(+)] X. kyIs4 contains a fragment of unc-76 protein that drives enrichment of GFP in the axons. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
CX2610 C. elegans lin-15B&lin-15A(n765) kyIs30 X. Show Description
kyIs30 [glr-1::GFP + lin-15(+)]. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
CX2993 C. elegans sax-7(ky146) IV; kyIs4 X. Show Description
kyIs4 [ceh-23p::unc-76::GFP + lin-15(+)] X. kyIs4 contains a fragment of unc-76 protein that drives enrichment of GFP in the axons. Posteriorly displaced nerve ring axons. This strain may contain lin-15(n765) X. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
CX3125 C. elegans sax-6(ky214) I; kyIs4 X. Show Description
kyIs4 [ceh-23p::unc-76::GFP + lin-15(+)] X. kyIs4 contains a fragment of unc-76 protein that drives enrichment of GFP in the axons. sax-6 is temperature sensitive. Posterior axon from amphid neuron. This strain may contain lin-15(n765) X. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
CX3137 C. elegans sax-9(ky212) IV; kyIs4 X. Show Description
kyIs4 [ceh-23p::unc-76::GFP + lin-15(+)] X. kyIs4 contains a fragment of unc-76 protein that drives enrichment of GFP in the axons. sax-9 is temperature senstive. Amphid axon guidance defects (termination, guidance). This strain may contain lin-15(n765) X. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
CX3260 C. elegans kyIs37 II. Show Description
kyIs37 [odr-10::GFP + lin-15(+)] II. No lin-15 mutation in background. Translational fusion; first few amino acids of odr-10. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
CX3465 C. elegans kyIs39. Show Description
kyIs39 [sra-6::GFP + lin-15(+)]. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
CX3572 C. elegans kyIs105 V; lin-15B&lin-15A(n765) X. Show Description
kyIs105 [str-3p::snb-1::GFP + lin-15(+)]. Also known as str-3::VAMP::GFP or ASI::VAMP::GFP or M7::VAMP::GFP. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
CX3596 C. elegans kyIs128 lin-15B&lin-15A(n765) X. Show Description
kyIs128 [str-3::GFP + lin-15(+)]. kyIs128 encodes a translational fusion contaning 4aa coding sequence (M7.13::GFP). Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
CX3662 C. elegans lin-15B&lin-15A(n765) X; kyIs121. Show Description
kyIs121 [unc-115::GFP + lin-15(+)]; autosomal. Maintain under normal conditions. Reference: Lundquist E, et al. (1998) Neuron 21(2):385-92.
CX3695 C. elegans kyIs140 I. Show Description
kyIs140 [str-2::GFP + lin-15(+)] I. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
CX3716 C. elegans lin-15B&lin-15A(n765) kyIs141 X. Show Description
kyIs141[osm-9::GFP5 + lin-15(+)]. GFP in sensory neurons.
CX3933 C. elegans kyIs140 I; slo-1(ky389) V. Show Description
kyIs140 [str-2::GFP + lin-15(+)]. ky389 is semi-dominant. str-2::GFP is expressed in both AWC neurons in ky389 mutants. PKA nsy-3(ky389).
CX3940 C. elegans kyIs140 I; rol-6(e187) II; slo-1(ky399) V. Show Description
kyIs140 [str-2::GFP + lin-15(+)] I. In ky399 mutants str-2::GFP is expressed in both AWX neurons. ky399 is a semi-dominant allele of slo-1, a large conductance potassium channel. PKA nsy-3(ky399). Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
CX4103 C. elegans kyIs150 IV; sax-1(ky491) X. Show Description
kyIs150 [tax-2(delta)::GFP + lin-15(+)]. sax-1 is temperature-sensitive. ky491 was isolated by PCR from a deletion library. [NOTE: (12/29/2020) This strain has been found to actually be carrying the ky491 deletion allele of sax-1, not the ky211 point mutation as previously reported.] ky491 is a 1263 bp deletion in sax-1 (left flanking sequence: atgaagcccagg ctgtgaataaattgaatg, right flanking sequence: ccaatcacagtcagcctccgataaaatgtc). Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
CX4828 C. elegans kyIs140 I; tir-1(ky388) III; him-5(e1490) V. Show Description
kyIs140 [str-2::GFP + lin-15(+)] I. Him. In tir-1 mutants str-2::GFP is expressed in both AWC neurons.
CX4998 C. elegans kyIs140 I; nsy-1(ky397) II. Show Description
kyIs140 [str-2::GFP + lin-15(+)] I. In nsy-1 mutants str-2::GFP is expressed in both AWC neurons.
CX5463 C. elegans slt-1(ok255) X. Show Description
Viable. Can be scored only using special neuronal markers such as zdIs5 [mec-4p::GFP + lin-15(+)], which labels the touch cells and shows that they have aberrant anterior processes in the slt-1 mutant.
CX5478 C. elegans lin-15B&lin-15A(n765) X; kyEx581. Show Description
kyEx581 [ocr-4::GFP + lin-15(+)]. GFP expression in OLQS. Maintain by picking non-Muv.
CX5757 C. elegans kyIs140 I; nsy-4(ky616) IV. Show Description
kyIs140 [str-2::GFP + lin-15(+)] I. 2-AWC OFF.
CX5893 C. elegans kyIs140 I; ceh-36(ky646) X. Show Description
kyIs140 [str-2::GFP + lin-15(+)] I. In ceh-36 mutants, both AWC cells fail to take on the AWC fate. ceh-36 is also required for the specification of the ASEL identity. ceh-36 encodes a member of the OTX/OTD family of homeodomain proteins. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
CX5922 C. elegans kyIs140 I; ceh-36(ky640) X. Show Description
kyIs140 [str-2::GFP + lin-15(+)] I. In ceh-26 mutants, both AWC cells fail to take on the AWC fate. ceh-36 is also required for the specification of the ASEL identity. ceh-36 encodes a member of the OTX/OTD family of homeodomain proteins. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
CX7102 C. elegans lin-15B&lin-15A(n765) qaIs2241X. Show Description
qaIs2241 [gcy-36::egl-1 + gcy-35::GFP + lin-15(+)].
CZ10175 C. elegans zdIs5 I. Show Description
zdIs5 [mec-4p::GFP + lin-15(+)] I. SK4005 was outcrossed 10x to produce this strain.
CZ11771 C. elegans nsf-1(ty10) I; muIs32 II. Show Description
muIs32 [mec-7p::GFP + lin-15(+)]. Egl, semi-Sterile, embryonic & larval lethality. Lethal in trans to Df. Defective fusion of anchor cell to uterine seam. Maintain under normal conditions. Reference: Choi J, et al., Dev Biol. 2006 Sep 1;297(1):87-102.
CZ13799 C. elegans juIs76 II. Show Description
juIs76 [unc-25p::GFP + lin-15(+)] II. GFP expression in GABAergic motor neurons. [NOTE: (10/11/2018) CZ13799 was sent as a replacement for CZ1200, which was found to carry background mutations affecting neuron morphology.] Derived by outcrossing CZ1200 to remove lin-15(n765) and unidentified background mutations. Reference (for original juIs76 strain): Huang X, et al. Neuron. 2002 May 16;34(4):563-76.
CZ1566 C. elegans lin-15B&lin-15A(n765) juIs109 X. Show Description
juIs109 [efn-4::GFP + lin-15(+)] X. Superficailly wild-type. GFP expression detected under high power in a subset of head neurons, primary vulval cells, and a pair of pharyngeal neurons. Reference: Chin-Sang ID, et al. Development. 2002 Dec;129(23):5499-510.
CZ1632 C. elegans juIs76 II; max-1(ju39) V. Show Description
juIs76 [unc-25p::GFP + lin-15(+)] II. Very mild Unc.
CZ1758 C. elegans juIs76 II; max-1(ju142) V. Show Description
juIs76 [unc-25p::GFP + lin-15(+)] II. Very mild Unc.
CZ1931 C. elegans juIs76 II; unc-71(ju156) III. Show Description
juIs76 [unc-25p::GFP + lin-15(+)] II. Unc.
CZ1935 C. elegans juIs76 II; unc-71(ju160) III. Show Description
juIs76 [unc-25p::GFP + lin-15(+)] II. Unc.
CZ23908 C. elegans rab-8(tm2526) I; muIs32 II. Show Description
muIs32 [mec-7p::GFP + lin-15(+)]. Homozygous viable. Reference: Kim KW, et al. Elife. 2018 Nov 21;7:e39756. doi: 10.7554/eLife.39756. PMID: 30461420
CZ2475 C. elegans juIs145 II. Show Description
juIs145 [flp-13p::GFP + lin-15(+)] II. GFP expression in ASE, ASG, ASK, I5 and DD1-DD6. Reference: Wu Z, et al. Proc Natl Acad Sci USA. 2007 Sep 18;104(38):15132-7. PMID: 17848506.
CZ25415 C. elegans nmat-2(ju1514) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III); muIs32 II. Show Description
muIs32 [mec-7p::GFP + lin-15(+)]. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP nmat-2(ju1514) homozygotes (sterile adults). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Reference: Kim KW, et al. Elife. 2018 Nov 21;7:e39756. doi: 10.7554/eLife.39756. PMID: 30461420
CZ29001 C. elegans muIs32 II; degt-1(ok3307) V. Show Description
muIs32 [mec-7p::GFP + lin-15(+)]. GFP-labeled touch receptor neurons showing wild-type-like morphology. Derived by out-crossing parental ok3307 strain to remove a linked mutation in rpm-1. Reference: Jin EJ & Jin Y. (2022). A mutation linked to degt-1(ok3307) in C. elegans strain VC2633 affects rpm-1. microPublication Biology. 10.17912/micropub.biology.000565. PMC ID: PMC9073554.]
CZ333 C. elegans juIs1 IV. Show Description
juIs1 [unc-25p::snb-1::GFP + lin-15(+)] IV. GFP expression in presynaptic terminals of GABAergic DD and VD motor neurons and RME neurons. Maintain under normal conditions. Reference: Hallan SJ and Jin Y. Nature. 1998 Sep 3;395(6697):78-82.