More Fields
Strain Species Genotype
MT4866 C. elegans let-60(n2021) IV. Show Description
Lethal suppressor of lin-15(n765).
MT5470 C. elegans lin-37(n758) III. Show Description
WT. Muv with lin-8, lin-38 or lin-15(n767).
MT6034 C. elegans lin-36(n766) III. Show Description
WT. Synthetic Muv with lin-8, lin-38 or lin-15(n767).
MT8190 C. elegans lin-15B&lin-15A(n765) nIs51 X. Show Description
nIs51 [egl-10(+) + lin-15(+)] X. Egl-C, Bor, hyperforaging, hyperactive locomotion, and male longevity and mating reduced. By Western blotting and staining the EGL-10 protein is highly overexpressed relative to N2. nIs51 was generated by injecting the lin-15 rescuing plasmid pEK1 at 50 ug/ml and the egl-10 rescuing fragment pMK21 at 80 ug/ml into MT1642 lin-15(n765) worms. The resulting strain was gamma irradiated and an integrant isolated, and was backcrossed to N2 four times. nIs51 was mapped to the right arm of X.
MT8457 C. elegans lin-15B&lin-15A(n765) X; nIs60. Show Description
nIs60 [vab-3::GFP + lin-15(+)]. Animals are non-Muv.
MT9971 C. elegans nIs107 III. Show Description
nIs107 [tbh-1::GFP + lin-15(+)] III. GFP expression in RIC. Reference: Alkema MJ, et al. Neuron. 2005 Apr 21;46(2):247-60.
NC216 C. elegans lin-15B&lin-15A(n765); wdEx75. Show Description
wdEx75 [acr-5::GFP + lin-15(+)]. Expressed in B-type motor neurons.
NC2913 C. elegans hdIs1 X; ufIs26. Show Description
hdIs1 [unc-53p::GFP + rol-6(su1006)] X. ufIs26 [unc-4p::mCherry + lin-15(+)]. Rollers. DA neurons marked with unc-4::mCherry and unc-53::GFP. unc-53::GFP expression in DAs is dim during L1. Can be used to isolate DA neurons by FACS. Used by CeNGEN project for RNA-Seq (https://www.cengen.org/).
NC3524 C. elegans ufIs26 II; vsIs13 IV. Show Description
ufIs26 [unc-4p::mCherry + lin-15(+)] II. vsIs13 [lin-11::pes-10::GFP + lin-15(+)] IV. GFP expression in six VC neurons and posterior intestine. VC neurons are labeled with both GFP and mCherry; co-labeling in VCs1-5 is brightest during L4 stage. Derived by crossing parental strains NC2957 and LX959. Can be used to isolate VC neurons by FACS. Used by CeNGEN project for RNA-Seq (https://www.cengen.org/).
NC3577 C. elegans ufIs26 II; otIs707. Show Description
ufIs26 [unc-4p::mCherry + lin-15(+)] II. otIs707 [bnc-1p(1.8kb)::GFP]. VB neurons are GFP+ only; VA and SABV have both mCherry and GFP. Can be used to isolate VB neurons by FACS. Used by CeNGEN project for RNA-Seq (https://www.cengen.org/).
NC3792 C. elegans ynIs37 III; ufIs26. Show Description
ynIs37 [flp-13p::GFP] III. ufIs26 [unc-4p::mCherry + lin-15(+)]. I5 neurons are labeled with GFP and RFP. Can be used to isolate I5 by FACS. Used by CeNGEN project for RNA-Seq (https://www.cengen.org/).
NG2501 C. elegans epi-1(gm121) kyIs5 IV. Show Description
kyIs5 [ceh-23p::unc-76::GFP + lin-15(+)] IV. kyIs5 contains a fragment of unc-76 protein that drives enrichment of GFP in the axons.
NG4370 C. elegans zdIs5 I; pig-1(gm344) IV. Show Description
zdIs5 [mec-4p::GFP + lin-15(+)] I.
NM1448 C. elegans jsIs37 rpm-1(js410) V. Show Description
jsIs37 [mec-7p::snb-1::GFP) + lin-15(+)]. Superficially wild-type. snb-1::GFP expression in a subset of mechanosensory neurons; GFP is faint and can only be seen on a compound microscope. Reduced SNB-1::GFP localization to synaptic regions; slighty Dpy. js410 has linked phenotype of reduced brood size. js410 is an R->Stop at aa 235. snb-1::GFP is expressed in mechanosensory neurons visible in the cell body and in the axon (very low levels). GFP puncta absent from the ventral nerve cord due to rpm-1 lesion.
NM1455 C. elegans jsIs37 rpm-1(js317) V. Show Description
jsIs37 [mec-7p::snb-1::GFP) + lin-15(+)]. Superficially wild-type. snb-1::GFP expression in a subset of mechanosensory neurons; GFP is faint and can only be seen on a compound microscope. Reduced SNB-1::GFP localization to synaptic regions; slighty Dpy. js317 is a W->Stop at aa 861. snb-1::GFP is expressed in mechanosensory neurons visible in the cell body and in the axon (very low levels). GFP puncta absent from the ventral nerve cord due to rpm-1 lesion.
NM1489 C. elegans dhc-1(js319) I; jsIs37 V. Show Description
jsIs37 [mec-7p::snb-1::GFP) + lin-15(+)]. Superficially wild-type. snb-1::GFP expression in a subset of mechanosensory neurons; GFP is faint and can only be seen on a compound microscope.May be slightly Unc. dch-1 alias sam-11.
NM2040 C. elegans dhc-1(js121) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III); jsIs37 V. Show Description
jsIs37 [mec-7p::snb-1::GFP) + lin-15(+)]. snb-1::GFP expression in a subset of mechanosensory neurons; GFP is faint and can only be seen on a compound microscope. Heterozygotes are GFP+ in the pharynx. dhc-1 homozygotes are GFP- and sterile or partially sterile pvuls. Homozygous sterile mutation balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP js121 homozygotes. Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain.
NM2415 C. elegans jsIs682 III; lin-15B&lin-15A(n765) X. Show Description
jsIs682 [rab-3p::GFP::rab-3 + lin-15(+)]. Expresses rab-3::GFP in most, if not all, neurons. rab-3::GFP is localized primarily to synaptic regions.
NM4244 C. elegans jsIs973 III; jsIs609 X. Show Description
jsIs973 [mec-7p::mRFP + unc-119(+)] III. jsIs609 [mec7p::mtGFP + lin-15(+)] X. Strong RFP cytosolic marker for the mechanosensory neurons (Zheng et al. 2011, PMID 21115607). GFP mitochondrial marker expressed in mechanosensory neurons (Mondal et al. 2012, PMID 23051668).
NM4422 C. elegans jsIs973 III; oxIs12 ptrn-1(tm5597) X. Show Description
jsIs973 [mec-7p::mRFP + unc-119(+)] III.  oxIs12 [unc-47p::GFP + lin-15(+)] X. oxIs12 integration maps at +2.0 on X. Strong RFP cytosolic marker for mechanosensory neurons (Zheng et al. 2011, PMID 21115607). Expression of GFP in all GABAergic neurons.
NM4431 C. elegans rep-1(ok3296) jsIs682/sC1 [s2303) [dpy-1(s2170)] jsIs682 III. Show Description
jsIs682 [rab-3p::GFP::rab-3 + lin-15(+)] III. rep-1(ok3296) homozygotes arrest as uncoordinated non-pumping starved L2/L3 animals with GFP::RAB-3 mislocalized to neuronal cell bodies. Presence of jsIs682 makes definitive identification of ok3296 homozygotes much easier. sC1(s2023) dpy-1 homozygotes are viable dpy animals. Heterozygotes are wild-type. Pick wild-type and check for correct segregation of progeny to maintain. ok3296 deletes 556 bp including the first 54 bp of exon 6 and has the sequence junction AGCTGAAACCGGTGCTACAG/CCATTCCTCTTCCCACTCTA. This strain replaces RB2411, which was an unbalanced heterozygous strain; also see NM4337. Reference: Dour S and Nonet ML. In preparation.
NM664 C. elegans jsIs37 IV; lin-15B&lin-15A(n765) X. Show Description
jsIs37 [mec-7p::snb-1::GFP) + lin-15(+)]. Superficially wild-type. snb-1::GFP expression in a subset of mechanosensory neurons; GFP is faint and can only be seen on a compound microscope.
NW1701 C. elegans mab-20(ev778) I; muIs32 II; him-5(e1490) V. Show Description
muIs32 [mec-7p::GFP + lin-15(+)]. Extensive ray fusion. Body morphology defects at larval stages. Embryonic and larval lethality.
OE3010 C. elegans lin-15B&lin-15A(n765) X; ofEx4. Show Description
ofEx4 [trx-1::GFP + lin-15(+)]. Animals with the array are non-Muv. Animals which have lost the array are Muv. lin-15(n765) is temperature sensitive. GFP expression in ASJ neurons and to some extent in posterior-most intestinal cells.
OH1003 C. elegans eno-9(ot9) oxIs12 X. Show Description
oxIs12 [unc-47p::GFP + lin-15(+)]. Ectopic DVB outgrowth.
OH10851 C. elegans juIs14 IV; unc-3(e151) X; otEx4812. Show Description
otEx4812 [unc-30p(2.6kb promoter)::unc-3(cDNA)::unc-54 3'UTR + myo-2::GFP]. juIs14 [acr-2p::GFP + lin-15(+)]. Maintain by picking myo-2::GFP(+) animals. Reference: Kratsios P, et al. Nat Neurosci. 2011 Nov 27. doi: 10.1038/nn.2989.
OH10997 C. elegans otIs264 III; ntIs1 V; otIs305. Show Description
otIs264 [ceh-36p::tagRFP] III. ntIs1 [gcy-5p::GFP + lin-15(+)] V. otIs305 [hsp-16.2p::che-1::3xHA::BLRP + rol-6(su1006)]. Rollers. Maintain at 15-20C. Reference: Tursun B, et al. Science. 2011 Jan 21;331(6015):304-8.
OH11053 C. elegans ntIs1 otIs305 otIs355 V. Show Description
ntIs1 [gcy-5p::GFP + lin-15(+)] V. otIs305 [hsp-16.2p::che-1::3xHA::BLRP + rol-6(su1006)] V. otIs355 [rab-3::tagRFP] V. Maintain at 15-20C. Rollers. Reference: Tursun B, et al. Science. 2011 Jan 21;331(6015):304-8.
OH11054 C. elegans pha-1(e2123) III; him-8(e1489) IV; ntIs1 V; otIs305; otEx4445. Show Description
ntIs1 [gcy-5p::GFP + lin-15(+)] V. otIs305 [hsp-16.2p::che-1::3xHA::BLRP + rol-6(su1006)]. otEx4445 [snb-1::NLS::RFP + pBX]. Rollers. Maintain by picking RFP+ Rollers. Maintain at 20C to maintain extrachromosomal array. Reference: Tursun B, et al. Science. 2011 Jan 21;331(6015):304-8.
OH11102 C. elegans lsy-6(ot71) otIs3 V; otEx5022. Show Description
otEx5022 [lsy-6(fosmid - delta 150 bp 3') + ttx-3::mCherry]. otIs3 [gcy-7p::GFP + lin-15(+)] V. Maintain by picking animals with mCherry expression in the AIY neurons. Fosmid with 150 bp deletion does not rescue ASE asymmetry.
OH11104 C. elegans lsy-6(ot71) otIs3 V; otEx5024. Show Description
otEx5024 [lsy-6(fosmid) + ttx-3::mCherry]. Maintain otEx5024 by picking animals with mCherry in the AIY neurons. otIs3 [gcy-7p::GFP + lin-15(+)] V. Integrated from adEx1288; genetically mapped between 3.05 m.u. (T19B10) and 5.86 m.u. (AH10) on V. GFP expression appears in ASEL and the excretory cell in adult animals.
OH11111 C. elegans lsy-6(ot71) otIs3 V; otEx5028. Show Description
otIs3 [gcy-7p::GFP + lin-15(+)] V. otEx5028 [lsy-6p::lsy-6(hairpin) + ttx-3::mCherry].
OH11113 C. elegans lsy-6(ot71) otIs3 V; otEx5030. Show Description
otIs3 [gcy-7p::GFP + lin-15(+)] V. otEx5030 [lsy-6p::lsy-6(hairpin)::lsy-6 1kb 3' + ttx-3::mCherry].
OH11630 C. elegans lsy-27(ot108) II; ntIs1 V. Show Description
ntIs1 [gcy-5p::GFP + lin-15(+)] V. 2 ASER.
OH128 C. elegans otIs39 II; him-5(e1490) V. Show Description
otIs39 [unc-47(delta)::GFP + lin-15(+)]. Expressed in RMEL/R, AVL, RIS, DVB, PVT and unidentified amphid sensory neuron pair.
OH13830 C. elegans sax-7(ot820) IV; oyIs14 V. Show Description
oyIs14 [sra-6::GFP + lin-15(+)] V. ot820 is an 8bp deletion 15bp from the start of the sax-7S start codon, resulting in a frameshift and sax-7S isoform-specific null allele.
OH14049 C. elegans otIs629; ntIs1 V. Show Description
otIs629 [gcy-7p::TagRFP + ttx-3p::GFP]. ntIs1 [gcy-5p::GFP + lin-15(+)] V. RFP expression in ASEL neurons. GFP expression appears in ASER (in adults) and AIY neurons. Reference: Patel T & Hobert O. eLife 2017.
OH1476 C. elegans lin-23(ot1) II; oxIs12 X. Show Description
oxIs12 [unc-47p::GFP + lin-15(+)]. Ectopic AVL outgrowth.
OH14783 C. elegans kyIs140 I; oig-8(ot818) II; otTi20. Show Description
kyIs140: [str-2::GFP + lin-15(+)] I. otTi20 [oig-8p::oig-8 + NeoR]. Single-copy mini-Mos insertion of rescuing oig-8p::oig-8 transgene.
OH14785 C. elegans kyIs140 I; oig-8(ot818) II; otTi22. Show Description
kyIs140: [str-2::GFP + lin-15(+)] I. otTi22 [str-1p::oig-8 + NeoR]. Single-copy mini-Mos insertion of rescuing str-1p::oig-8 transgene.
OH14864 C. elegans kyIs140 I; oig-8(ot818) II; otTi24. Show Description
kyIs140: [str-2::GFP + lin-15(+)] I. otTi24 [ceh-36(prom3)::oig-8 + NeoR]. Single-copy mini-Mos insertion of rescuing ceh-36(prom3)::oig-8 transgene.
OH15487 C. elegans otIs695. Show Description
otIs695 [nlp-3p::GFP + lin-15(+)]. Reference: Vidal B, et al. bioRxiv 2021.11.30.470650; doi: https://doi.org/10.1101/2021.11.30.470650
OH15655 C. elegans otIs711. Show Description
otIs711 [nlp-8p::GFP + lin-15(+)]. Reference: Vidal B, et al. bioRxiv 2021.11.30.470650; doi: https://doi.org/10.1101/2021.11.30.470650
OH1589 C. elegans lin-23(ot1) II; oxIs12 X; otEx840. Show Description
otEx840 [lin-23::GFP + rol-6(su1006)]. oxIs12 [unc-47p::GFP + lin-15(+)]. Maintain by picking Rollers.
OH16003 C. elegans otIs742. Show Description
otIs742 [nlp-13p::GFP + lin-15(+)]. Reference: Vidal B, et al. bioRxiv 2021.11.30.470650; doi: https://doi.org/10.1101/2021.11.30.470650
OH16144 C. elegans nIs175 IV. Show Description
nIs175 [ceh-28p::4xNLS::GFP + lin-15(+)] IV. GFP expression in M4 neurons can be used to isolate M4 by FACS. Used by CeNGEN project for RNA-Seq (https://www.cengen.org/).
OH16816 C. elegans otIs809. Show Description
otIs809 [glr-7::GFP + lin-15(+)]. Reference: Vidal B, et al. bioRxiv 2021.11.30.470650; doi: https://doi.org/10.1101/2021.11.30.470650
OH172 C. elegans lin-15B&lin-15A(n765) X; otEx105. Show Description
otEx105 [lim-7::GFP + lin-15(+)]. Highly penetrant line, but non-Muv/Muv does not correlate well with presence/absence of extrachromosomal array. Maintain by picking GFP-positive animals under GFP-dissecting scope. GFP strongly expressed in gonad sheath cell pair 1.
OH2000 C. elegans lin-23(ot1) II; oxIs12 X; otEx1076. Show Description
otEx1076 [unc-47p(long)::lin-23cDNA(yk784a08) + rol-6(su1006) + pBS]. oxIs12 [unc-47p::GFP + lin-15(+)]. Maintain by picking Rollers.
OH2042 C. elegans lin-49(ot78) dpy-20(?) IV; otIs3 V. Show Description
otIs3 [gcy-7::GFP + lin-15(+)] V. Whole genome sequenced strain.