VC4047 |
C. elegans |
lgc-5(gk5121[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) IV. Show Description
Homozygous viable. Deletion of 2700 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: CAGATTATTTTCATATAGTTGATTCCTGAC ; Right flanking sequence: GCTGGATATAAGCATCGCAGAGACACTCAG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
FX30151 |
C. elegans |
tmC9 IV. Show Description
Break points: In(glb-19 lgc-52 In(mec-3 unc-31)) IV. Covered region (Mb) 4.8 (10.5..15.2) Unc Mec. Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.
|
|
FX30234 |
C. elegans |
tmC9 [F36H1.2 (tmIs1221)] IV. Show Description
Break points: In(glb-19 lgc-52 In(mec-3 unc-31)) IV. Covered region (Mb) 4.8 (10.5..15.2) Balancer marked with myo-2p::Venus. Unc Mec. Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.
|
|
MT13952 |
C. elegans |
lgc-53(n4330) X. Show Description
1.463 kb deletion in T21F2.1 encoding ligand-gated chloride channel. Homozygous viable.
|
|
MT14680 |
C. elegans |
lgc-55(n4331) V. Show Description
1.986 kb deletion in Y113g7A.5 encoding ligand-gated chloride channel. Homozygous viable.
|
|
MT20492 |
C. elegans |
lin-15B&lin-15A(n765) X; nIs471. Show Description
nIs471 [lgc-55::GFP + lin-15(+)]. GFP expression in GLR glia-like cells and head muscles. Reference: Ringstad N, et al. Science. 2009 Jul 3;325(5936):96-100.
|
|
ZM10484 |
C. elegans |
unc-25(e156) III; hpIs321; hpIs331; ljIs131. Show Description
hpIs321 [nmr-1p::miniSOG::UrSL2::wCherry + lin-15(+)]. hpIs331 [lgc-55p::miniSOG::UrSL2::wCherry + lin-15(+)]. ljIs131 [myo-3p::GCaMP3::UrSL2::tagRFP-T]. Shrinker. Dorsal-coiler in L1, kinker in Adult after 1 hr illumination with blue light. Reference: Lu Y, et al. 2022. Current Biology (In Press).
|
|
ZM7465 |
C. elegans |
hpIs321; hpIs331; ljIs131. Show Description
hpIs321 [nmr-1p::miniSOG::UrSL2::wCherry + lin-15(+)]. hpIs331 [lgc-55p::miniSOG::UrSL2::wCherry + lin-15(+)]. ljIs131 [myo-3p::GCaMP3::UrSL2::tagRFP-T]. Reference: Lu Y, et al. 2022. Current Biology (In Press).
|
|
ZM7765 |
C. elegans |
unc-77(gk9); nca-2(gk5); hpIs166; hpEx3239. Show Description
hpIs166 [glr-1p::chop-2(H134R)::YFP + lin-15(+)]. YFP expression in glr-1 interneurons. hpEx3239 [lgc-55p::nca-1::GFP + nmr-1p::ATG::nca-1 + nca-1::GFP + myo-2p::RFP]. Pick RFP+ to maintain. Reference: Gao S, et al. 2015 Nature Communications 6, Article number: 6323.
|
|
ZM9176 |
C. elegans |
hpIs603. Show Description
hpIs603 [lgc-55Bp::tomm20::miniSOG::SL2::BFP + nmr-1p::tomm20::miniSOG::SL2::BFP + acr-5p::tomm20-miniSOG-SL2::BFP + lin-15(+)]. MiniSOG neuron ablation of all premotor interneurons, B-class motor neurons (B-MN), and other neurons. Reference: Gao S, et al. eLife 2018 Jan 23;7:e29915. PMID: 29360035
|
|