Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of lgc-1. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: cagTGGCAACCTACAACAAATTTCTCGCCGATCAA right flanking sequence: AAACGGCTTTGGGATGATTTATTCAAAGATTATGAC inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: AATTTCTCGCCGATCAAAAA Method Reference: G3 (Bethesda).

No obvious phenotype. 446 bp deletion. Attribution: This strain was generated by the National Bioresource Project at the Tokyo Women's Medical University School of Medicine, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

ufIs126 [flp-13p::acr-12::GFP + lgc-11::mCherry] V. ACR-12::GFP expression labels postsynaptic iAChRs in DD motor neurons. References: Philbrook A, et al. eLife. 2018 Jul 24;7:e35692. doi: 10.7554/eLife.35692. PMID: 30039797. Oliver D, et al. PLoS Genet. 2022 Jan 28;18(1):e1010016. doi: 10.1371/journal.pgen.1010016. PMID: 35089924. Alexander K, et al. bioRxiv 2022.10.21.512874; doi: https://doi.org/10.1101/2022.10.21.512874.

Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of lgc-16; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GTCACATTATTTTCATTTTCTGACATTTCCGCAT Right flanking sequence: TTTATCATGATCCAGGATTATATGgtaaagtttgg inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : TCCTGGATCATGATAAAATG Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616

Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of lgc-18. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: gtttttattcaaaatgttaattcttcattttgcagTTCCG right flanking sequence: GAATGGAACAATTTCTTGGAGAATCAAGTTAAAC inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TTCATTTTGCAGTTCCGGAA Method Reference: G3 (Bethesda).

Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of lgc-19. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CTATCGATTCTTTTTTCTTTGATCCAGAGTTATAC right flanking sequence: Ggtaggctattttggctttcaggctcaaaaaaggtg inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TTGATCCAGAGTTATACGGT Method Reference: G3 (Bethesda).

R13A5.4. External left primer: AGCGAGAGCTGGTGAAACAT. External right primer: CTCGGACAATTTTCGCGTAT. Internal left primer: CCAATTTACTCGACCTGTAAAAA. Internal right primer: TGCATCAAATTAGGTGTCCG. Internal WT amplicon: 1216 bp. Deletion size: 744 bp. Deletion left flank: ACGTAAGTTATGGTAAATAACATACTTTTT. Deletion right flank: GCAATACCGTTCCAGCATTTTCACAGTTAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Homozygous viable. Deletion of 972 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TCGAAAAATTAAAGGAAATTGAACAGTAAG. Right flanking sequence: TGGAGGTGCAAGAGCCAGAAGAAAAAGTAT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 769 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: GACTTCTTCCGCGTTTTCTAACCACTTTCC. Right flanking sequence: AGGTCAACGAGAAGTTATTGTTCCACAAAC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 877 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: AAACAACTGTAACTCTGAAACTATTGAAGC. Right flanking sequence: TGGACACGATCCAGACGCCCCGGGACGGTG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 2024 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: ATTATGAAAAAGATGTCTCTCCCGTGTATG ; Right flanking sequence: GCATTGGGCAATCTCATGTTTCATTTGACA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 1770 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: CGAGAGCTTTCTGGCATTTCCTAACCACCG ; Right flanking sequence: CTTGGTGTCTATATCATTGTGAATCTTGCA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.