More Fields
Strain Species Genotype
SP226 C. elegans mnDp1 (X;V)/+ V; let-9(mn107) unc-3(e151) X. Show Description
Pick WT to maintain. Throws WT, Sterile Uncs, and dead eggs(homozygous Dp).
BC1291 C. elegans let-93(s734) unc-22(s7) unc-31(e169)/nT1 IV; +/nT1 V. Show Description
Heterozygotes are WT and segregate WT, Vul, UncLet and dead eggs. Lethal mid-larval. Maintain by picking WT.
BC2001 C. elegans let-98(s1117) unc-22(s7) unc-31(e169)/nT1 IV; +/nT1 V. Show Description
Heterozygotes are WT and segregate WT, Vul, UncLet and dead eggs. Lethal late larval. Maintain by picking WT.
BC2003 C. elegans let-96(s1112) unc-22(s7) unc-31(e169)/nT1 IV; +/nT1 V. Show Description
Heterozygotes are WT and segregate WT, Vul, Lethal Twitchers and dead eggs. Lethal mid-larval. Maintain by picking WT.
BC2013 C. elegans unc-22(s7) let-97(s1121) unc-31(e169)/nT1 IV; +/nT1 V. Show Description
Heterozygotes are WT and segregate WT, UncLet (Twitcher), Vul, and dead eggs. Lethal early larval. Maintain by picking WT.
BC220 C. elegans dpy-14(e188) unc-13(e51) let-90(s140)/unc-15(e73) I. Show Description
Heterozygotes are WT and segregate WT, paralyzed Unc and DpyUncLethal. The DpyUncs are abnormal larvae. Pick WT to maintain.
BC2903 C. elegans let-92(s504) unc-22(s7)/nT1 IV; +/nT1 V. Show Description
Heterozygotes are WT and segregate WT, Vul, dead eggs and UncLets. Lethal early larval. Maintain by picking WT.
BC2907 C. elegans let-91(s678) unc-22(s7)/nT1 IV; +/nT1 V. Show Description
Heterozygotes are WT and segregate WT, mid-larval lethals that Twitch, Vuls and dead eggs.
BC3119 C. elegans unc-5(e152) unc-22(s7) let-99(s1201) unc-31(e169) IV/nT1 IV; +/nT1 V. Show Description
Heterozygotes are WT and segregate WT, Egl, UncLet (maternal effect lethal) and dead eggs. Maintain by picking WT.
BC4151 C. elegans dpy-17(e164) let-972(s2441) unc-32(e189) III; sDp3 (III;f). Show Description
Maintain by picking Uncs. DpyUncs arrest at early larvae. s2441 previously assigned to let-703.
EU1472 C. elegans let-99(or204) IV; him-5(e1490) V. Show Description
let-99(or204) is temperature-sensitive, maternal-effect, embryonic-lethal. Nearly completely penetrance of lethality at 26C. Viable at 15C. Maintain at 15C. Reference: Goulding MB, et al. J Cell Biol. 2007 Sep 24;178(7):1177-91.
EU363 C. elegans let-99(or81) IV/nT1 [unc-?(n754) let-?] (IV;V). Show Description
Heterozygotes are Unc.
RV120 C. elegans spe-44(ok1400) dpy-20(e1282)/let-92(s677) unc-22(s7) IV. Show Description
Pick wild-type to maintain.
SSM42 C. elegans let-92(ok1537) IV/nT1 [qIs51] (IV;V). Show Description
Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP gk526 homozygotes (variable arrest, early larval). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain.
TH112 C. elegans let-99(dd17) IV/nT1 [qIs51] (IV;V). Show Description
let-99(dd17) contains a 647bp deletion with the flanking sequences aatttttaggaagtttccagaaatttttcc / CAAGGCTCCCACGAAGATTATCGCGATCTA. The deletion removes the N terminus of the open reading frame including the start codon and the DEP domain. Heterozygotes are GFP+ in the pharynx. dd17 is a maternal effect lethal mutation.
TH113 C. elegans let-99(dd18) IV/nT1 [qIs51] (IV;V). Show Description
let-99(dd18) contains a 1039bp deletion with the flanking sequences TTTGGATGAGTTGAAGCATCCCAAGCCCCG / ATGAATGCTCTCTTATTGTTAATCTCCTCT. The deletion starts behind the DEP domain. Heterozygotes are GFP+ in the pharynx. dd18 is a maternal effect lethal mutation.
VC940 C. elegans let-99(ok1403) IV/nT1 [qIs51] (IV;V). Show Description
K08E7.3. Homozygous sterile deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1 aneuploids, and non-GFP ok1403 homozygotes (Mel; adult lays eggs, some hatch into abnormal L1s that arrest). nT1[qIs51] homozygotes inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807