Y106G6H.7. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2187 homozygotes (sterile, no eggs). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GGAGCCTTTTGAGAAACACG. External right primer: CATAAGAAAGCTTCGCAGGC. Internal left primer: CCCTGCCACTGTGACAATTA. Internal right primer: GGAGCCAAATGGAAGAAACA. Internal WT amplicon: 3170 bp. Deletion size: 1128 bp. Deletion left flank: ATACTGCCTGTGCGACTCCAAATGCCAACT. Deletion right flank: AGTTTTTCAGAAATTAAAAAACCTTTATTG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

ok3356. Homozygous constitutive dauer deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok3356 homozygotes (constitutive dauer, probably non-recovering). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CGCCAAGAAGTGAAGATTCC. External right primer: ACGCTTGTAATGCCGAAAGT. Internal left primer: GCAAATGCTTCAAAAGAGCC. Internal right primer: GAGTCCGAGCAATTCTGAAAA. Internal WT amplicon: 1122 bp. Deletion size: 367 bp. Deletion left flank: AGGAACATTTCATCCGTATGGTCGTTTCTA. Deletion right flank: TTTGGAGGATTAATCGAGTTTTGAAGGTGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

K02B12.1. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok3388 homozygotes (early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TCTCTTTCTTCCAGCTTGCC. External right primer: TAGGGCCAGAAAATTGAACG. Internal left primer: AAATGTAGAATTGGGCGAGC. Internal right primer: GGTAGGCGCACATACCATTT. Internal WT amplicon: 1129 bp. Deletion size: 405 bp. Deletion left flank: TCTGAATAATTTCAGGTCGTTCAACTTCCT. Deletion right flank: AAAATGGTATGTGCGCCTACCAATTGAAAA. Insertion Sequence: AAAAGGATTCA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y39G10AR.2. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2378 homozygotes (sterile Unc). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GCGCGAAAACAAAACAATTT. External right primer: TGAGGAAATTTCGGCTCATT. Internal left primer: TTTCCCAGAAAATGCCACTC. Internal right primer: GCAACTCTGGCATGCTTTTT. Internal WT amplicon: 2881 bp. Deletion size: 2093 bp. Deletion left flank: CAGCGGTTGTGACAAAGAAAAGTGTGCGAA. Deletion right flank: TTGCAACGGAGAATCGACCGGCTCCTGGCG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

R06C1.3. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok3308 homozygotes (sterile, no eggs). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GAAAAGCTGGGACTTCGTTG. External right primer: TTTTGGCTGCTCGCTTTTAT. Internal left primer: GGGTTTCTAGCGATTTTTCCA. Internal right primer: ACGATTTTCGTGCCAATTTC. Internal WT amplicon: 1322 bp. Deletion size: 556 bp. Deletion left flank: TTGGCCTGCTCGGGGAGCACAAGAGCTGTG. Deletion right flank: CTGTAGGTAAAGTGCTTCTATCCAGAATAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y110A7A.8. Apparent homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP gk1094 homozygotes (arrest stage/phenotype undetermined). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. (Note: in this strain hT2[qIs48] occasionally recombines such that the GFP and its associated lethality are lost and the non-GFP hT2 left behind still carries the bli-4 mutation of the original hT2. Such a recombination event results in a viable non-GFP animal that is no longer gk1094/hT2[qIs48] but is gk1094/hT2.) External left primer: TTTCATTCTCTTCGCGACCT. External right primer: CACACTCCAGCACTGGAAAA. Internal left primer: TGCAGCAATGAAGAGAAACG. Internal right primer: TTTCGCATATGGGTCGAAAT. Internal WT amplicon: 2229 bp. Deletion size: 1953 bp. Deletion left flank: AGCGAACTGCAGCAATGAAGAGAAACGAGA. Deletion right flank: ATATATTTATTTGTTACTTTCCTCTTCCTG. Insertion Sequence: GAACG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F21C3.5. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok3600 homozygotes (mid-larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TGAATTTGTGGTTGGGGATT. External right primer: ATTTCAACGCTGCTGGAGAC. Internal left primer: ATGATGGCTGACTTTGAGCA. Internal right primer: TGCAAAGTTGGTTTTCACGA. Internal WT amplicon: 1193 bp. Deletion size: 445 bp. Deletion left flank: ATTTTAAAACGTTTAAAGGTAAAATTTATT. Deletion right flank: AAAAGAAGTGAAAGAAAACAAAATTGTGTT. Insertion Sequence: AT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

K02F2.2. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok3601 homozygotes (mid- to late-larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: ACGAGGAATACGAATGGTGC. External right primer: CGAAATGAGTGAAGCGTTGA. Internal left primer: CAAGGATGGACAACCACTCA. Internal right primer: CGGGTAGATGGGGAACAATA. Internal WT amplicon: 1126 bp. Deletion size: 715 bp. Deletion left flank: AAAGGGATCTGCTGCTTCCCTCAAGGCTTT. Deletion right flank: AAATTGTATTGCCCTCAAACTTCATATGAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C08C3.4. Homozygous viable deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok3550 homozygotes (phenotype uncharacterized). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TTACTTTTATGCCGGCCAAC. External right primer: AGCACTAGAAATGCGCCAGT. Internal left primer: TGTCGACGAGAACTGACATTG. Internal right primer: CTTTTCTTCAATTTCCGCGA. Internal WT amplicon: 1184 bp. Deletion size: 589 bp. Deletion left flank: GCTGTTTGGGTCACATTGAGACATGGCGCA. Deletion right flank: AGTGGTTTCCTCATTGGGCAGAAGGTGATG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C18E3.2. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok3161 homozygotes (sterile, eggs don't hatch). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CCAGGAAGTGCTCCACAAAT. External right primer: AACTCGTGTCGCTTCTGGTT. Internal left primer: CCATTGCCGAAAAAGAAGAA. Internal right primer: CACCTTTTGGAACATGTATCTG. Internal WT amplicon: 1250 bp. Deletion size: 1122 bp. Deletion left flank: AAAGAAGAAGTATGCGGATAAATGTATTCA. Deletion right flank: GAGGAAGGAGTTCAAAGGTATTTGCCGTTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

H28O16.1. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2203 homozygotes (probable embryonic arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: AAATCCTGACAGCTCGTTGG. External right primer: TTCGAAACAGGAGCTTTGCT. Internal left primer: TGTTGTCCAAACGCATTGTT. Internal right primer: ATTCTCGCAGAACACACACG. Internal WT amplicon: 2289 bp. Deletion size: 1121 bp. Deletion left flank: GACGTGTTGTTGACGCCCTCGGAAACCCAA. Deletion right flank: ATACCTCGACAAGGTCGACCCATCCGCCAT. Insertion Sequence: A. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y106G6H.3. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok3566 homozygotes (early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. xternal left primer: CCAAAAACCGGAAAAAGACA. External right primer: AAAAACGTCCGATGCAATTC. Internal left primer: AGTGTTTCAAGGGAGGAGGG. Internal right primer: TCCATCCGTGACATCGTTTA. Internal WT amplicon: 1153 bp. Deletion size: 474 bp. Deletion left flank: ATTAGAAGTTCACGCAGTTATTTTTTCTAT. Deletion right flank: CTACAACGGAAACAACATTGAGCTCGGAAC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y79H2A.3. Maternal-effect lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP gk1219 homozygotes (Mel; F2 homozygotes arrest as early larvae). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: AAACATGCTTCTTCCATGCC. External right primer: AGCGAAATTTGGACTAGCGA. Internal left primer: TTCATTGCGTGATATTCCGA. Internal right primer: TCTGGACGTGTGCTACTTGC. Internal WT amplicon: 1396 bp. Deletion size: 1073 bp. Deletion left flank: GTTCATCACCAGCATTAATGAGATATCGAT. Deletion right flank: TAGCTAATTTTGAACCGCCATAAAACTTTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C50F2.3. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok3662 homozygotes (embryonic or early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: AATGGCCGACAAAGAAAATG. External right primer: TTTTTCCAACTTTTCCGTGC. Internal left primer: ATGCCGAACTCTGAGACGAT. Internal right primer: AAAAGTTGGCGAAATTGGTG. Internal WT amplicon: 1186 bp. Deletion size: 656 bp. Deletion left flank: TGGAGAGCACTCTGTGACACTTATGAGAGA. Deletion right flank: CGAGAAGTGTCGATTATGATGCAAGAAGTG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

R151.2. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP gk3067 homozygotes (sterile, eggs don't hatch). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CACAAAGATCACTCAATCCATCA. External right primer: AACATCGTCGTTCAGAATCTCAT. Internal left primer: TTTCTCTTGGGACCTTTGGTAA. Internal right primer: AAAATGAGCAGAATCGAATGGT. Internal WT amplicon: 1962 bp. Deletion size: 1090 bp. Deletion left flank: AGTTTTGGCAACTTATCAGTTAGAATAAAA. Deletion right flank: CCTCAAAATTTCAGATTGGTTGAAGCCGGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F22D6.6. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok1197 homozygotes (sterile, no eggs). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CCGTACACATTCATCGTTGC. External right primer: CGGTATGTGTGGATGTCGAG. Internal left primer: GCAATGCTCTTCTCTGTCCC. Internal right primer: GAGATCAATTTGGCCATTCG. Internal WT amplicon: 2672 bp. Deletion size: 1008 bp. Deletion left flank: ATTTTTTAAAGAACTGGAAGAAATGCGAAT. Deletion right flank: TGTGAGTGAATATAACCAAAACACCAATGC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

K11D9.2. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok3768 homozygotes (probable early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: AAGAACCACCACATTGAGGC. External right primer: GGAGAAGCCACTGAAACTGC. Internal left primer: GAGTCCATCGTTGGCTGAAC. Internal right primer: TGAGAAGATGAATGTTTTCGGA. Internal WT amplicon: 1129 bp. Deletion size: 763 bp. Deletion left flank: GAGAGCAGTGGCTGGAAGACCGTCAGTGAC. Deletion right flank: TGAGTCATGGCAGAGGTGAGTGGAACCTTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F20G4.1. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2423 homozygotes (early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TCCAACCAATCCAGCTTTTC. External right primer: CCAAAACGAGAAGACGGAGA. Internal left primer: TTCGACTTTTTCGGCGAT. Internal right primer: ATGGAACATCCTGATGCTGA. Internal WT amplicon: 1173 bp. Deletion size: 637 bp. Deletion left flank: TTCTAAAAATAATTAAATTAGAGTGTTAAA. Deletion right flank: CGTATGGTTGCCACGTCGCGAGATCATGAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y66A7A.8. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP gk3098 homozygotes (embryonic or early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: ATATTGAAAACTAGGAACTTGGCG. External right primer: CCTACCAGAATCAGTATGCACATC. Internal left primer: CTGAATTTGTTCCATTGTTAGAAAGA. Internal right primer: CTTAAAGTCAAAAACAAACGTTCAAA. Internal WT amplicon: 1543 bp. Deletion size: 474 bp. Deletion left flank: AGGATTAGGCATAGGTTTAGGCTTAGGGTT. Deletion right flank: TTGTAGTTGGATTCTGGATTGAGATGCTCG. Insertion Sequence: GGGCTTAGGATAAAGCTTTGGCTCACGCTTAGGTTTAGGATTAGGTATAGGTTTAGGCT TAGGGTTAGGCTTAGGGTTAGGCTTAGGC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Homozygous sterile deletion chromosome (gk3086 in F45H11.2) balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP gk3086 homozygotes (late larval arrest or sterile adult). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CGCGATGAGACCCATCTATT. External right primer: CGACAATGTGGTCGTTTTTG. Internal left primer: CTTGTGTCGATTTACGGGCT. Internal right primer: ATGGAAGAGTGCAAGTTCGG. Internal WT amplicon: 1685 bp. Deletion size: 1145 bp. Deletion left flank: ATTCTCAGGATTTTTTGTTACCATAGTGTT. Deletion right flank: TCTTACAAATACTGCGCGTTCTGATCTCCT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F46F11.4. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP gk3358 homozygotes (early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GCCCTCCGAAGAGAGCTTAT. External right primer: TCGCTGCCTAAACTTTTCGT. Internal left primer: ATTGCCCTTGGTCTGAAATG. Internal right primer: GTGCATGCGCCTTTAAGTTT. Internal WT amplicon: 1544 bp. Deletion size: 487 bp. Deletion left flank: GTTATTAATGTTTTTTCTCATGTAAAATAT. Deletion right flank: GTGATTTCAATCATTTTTCCTGAAAGGTCA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

B0261-4. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok1340 homozygotes (sterile adult). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TTCAAGCTTTTGCACCTCCT. External right primer: TGTGGCTGCTTTGTTCTGTC. Internal left primer: CTGGAGTTTTGCGGACTTTC. Internal right primer: TCTGCCGATTTAGTGCATTG. Internal WT amplicon: 2114 bp. Deletion size: 620 bp. Deletion left flank: AAATTTAAATTTAAGGTATGTGTGCTTGAA. Deletion right flank: CCATTGTTCTTTTTTCTTGATATTTTGAAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

B0280.10. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok1292 homozygotes (early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TCGTTCCGGTCTTCGTCTAC. External right primer: ACTTTCAGCTCCAGACGCTC. Internal left primer: CGCAGCAACATCATTCAAAC. Internal right primer: ATAGATTGAGCGCCGAGAAG. Internal WT amplicon: 2359 bp. Deletion size: 916 bp. Deletion left flank: CTCATCAAGTTGATCAGTTTGCTGAGTTCA. Deletion right flank: CCTGAATATTTTTTTTGAATCTAGTAACTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Homozygous sterile deletion chromosome (ok395 in T17E9.1) balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok395 homozygotes (sterile). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CATCAACCAGTTGCATCCAC. External right primer: TTACTGAGTTGTTGCCTGCG. Internal left primer: GACGCCATCCTCGATTTTTA. Internal right primer: CTCGATTCAGATCGGCTTTC. Internal WT amplicon: 3219 bp. Deletion size: 1767 bp. Deletion left flank: ATAATTTTCGATAGAAAAATGTATATTAAT. Deletion right flank: GAAGTAGTTCGACGACGAGCTCCGCACGCC. Insertion Sequence: AGAAAAATGTATATTAATC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C50C3.6. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP gk3511 homozygotes (early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: ACAACAACTGGGAAACTCCG. External right primer: ACTGAACATGGGCATCAACA. Internal left primer: AATTACGAAATCGCCGTTTG. Internal right primer: TCTCTGCACAAATGGAATGC. Internal WT amplicon: 2731 bp. Deletion size: 1823 bp. Deletion left flank: TTTTTTTTAAGTTGGACAGTTTTTAAAGTT. Deletion right flank: GCAACTTGAAAGCAGTGAGTTATTTACAAG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y69F12A.2. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP heterozygotes, arrested hT2 aneuploids, and possibly non-GFP gk3392 homozygotes (if not Emb; undetermined). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain.External left primer: CGGATCTGTCTGGTGGACTT. External right primer: GTTTCCAGCCGATACGACAT. Internal left primer: GCAACAGCGGATATTGTTGAT. Internal right primer: CAATTTTCACGTCCATGTCCT. Internal WT amplicon: 1413 bp. Deletion size: 709 bp. Deletion left flank: TCCAGGTGGACCATCTCAACGTATTGCCTA. Deletion right flank: ATTACTGGACTTTCCGATGAAGCTAGAGCT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F39H2.1. Homozygous lethal or sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP gk1201 homozygotes (variable arrest, at least some animals persist to sterile adulthood). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GACGGTTTCCTTTTGAGCAG. External right primer: ATCCACTTGGGTTTCGTTTG. Internal left primer: TTCCGGAAACCGCATATTAG. Internal right primer: TTACGCAATGCACACACTGA. Internal WT amplicon: 2028 bp. Deletion size: 471 bp. Deletion left flank: TCAGCAAAATGGATGAGATTTGGAAAGCGT. Deletion right flank: TTTTTGAAGATCAAAGCGAAATAAGACATT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C23G10.8. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP gk3389 homozygotes (mid-larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GCATTGAATCTCCCGTGTCT. External right primer: ATACTCAGTCAACGGCCAGG. Internal left primer: TGCATTCGTTTATCCATCCA. Internal right primer: TGTTTGAACTGCTTTGCCTG. Internal WT amplicon: 1992 bp. Deletion size: 418 bp. Deletion left flank: TCAAGTTTCAGCGAATTAAAAAGCTTCTCA. Deletion right flank: GGCCATCCACTCCATGAACGTTTTATCGTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C43E11.10. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok1368 homozygotes (early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CAGAACGTGTACCCGAAGGT. External right primer: TTCCCGATGCTTCACTTTCT. Internal left primer: AGAGAACGCGTTGAAAGGAA. Internal right primer: TTCACCCCTTTCGTGGATAG. Internal WT amplicon: 2704 bp. Deletion size: 1290 bp. Deletion left flank: TGATAGCCGATTTTGCCGTCGGAGCATCAA. Deletion right flank: TAATTTCTTCGCTGTCAGATTCCGATGAGC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

K07G5.1. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP gk3542 homozygotes (sterile, lays some eggs but none hatch). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TTGCCTTTTGTAGATGTGATAGGA. External right primer: TAATCCGAAAGTCACAAAATCTGA. Internal left primer: GTCCCCACAGATGACGTTCT. Internal right primer: CCTTGCATCAGCTTTTCACA. Internal WT amplicon: 1884 bp. Deletion size: approximately 1125 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP gk3614 homozygotes (mid- to late-larval arrest, thin and slightly uncoordinated, sometimes with protruding vulval tissue). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use.

F25H2.9. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok1808 homozygotes (mid-larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TGGAGTGTTCACAAACCCAA. External right primer: TGGATTCTTTCCGAGGTGTC. Internal left primer: GCTCTGTCACCTCGAAGACC. Internal right primer: GCGGACGTATTGAATGTGTG. Internal WT amplicon: 2116 bp. Deletion size: 880 bp. Deletion left flank: GAGTACGATCGTGGAGTCAACACTTTTTCT. Deletion right flank: TTATTTGTCGTTCTTTTATACATTTTTGAA. Insertion Sequence: AAAAAATAGAAAAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Homozygous embryonic lethal mutation balanced by bli-4- and GFP-marked translocation. Maintain at 15 C. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP e2406 homozygotes (embryonic arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Reference: Bembenek J, et al. Curr Biol (2010) Feb 9;20(3):259-64.

Homozygous sterile deletion balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP bn115 homozygotes (sterile). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Reference: Kim J, et al. (2009) Mol Cell 28:43-8.

Heterozygotes are WT and GFP+. Segregate syp-3(me42) homozygotes that are non-GFP and lay mostly dead eggs; these mutants form abnormal synaptonemal complex formation during meiosis. Homozygous hT2[bli-4 let-? qIs48] animals are inviable.

Heterozygotes are WT and segregate WT, paralyzed Unc and DpyUncLethals. The DpyUncs are abnormal larvae which die in late larval development. Pick WT to maintain. s90 previously called let-77. See also WBPaper00003507. CGC received new stock 3/01.

qaIs3502 [pie-1p::YFP::lmn-1 + pie-1p::CFP::H2B + unc-119(+)]. Germline expression of YFP::lmn-1. CFP::HIS is silenced in qaIs3502. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP sterile homozygotes (produce only dead embryos). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Derived from strains XA3502 and XA3503. Reference: ima-2(ok256) is described in Askjaer et al., Mol Biol Cell. 2002 Dec;13(12):4355-70.

umnIs42 [myo-2p::mKate2 + NeoR, I: 6284001 (intergenic)] III. Heterozygotes are WT mKate2+ and segregate WT mKate2+, DpyUnc, lethal mKate2+ hT2 homozygotes (arrest stage unknown) and dead eggs (aneuploids). Will throw an occasional mKate2+ Dpy non-Unc (similar events were observed in the parental hT2 strain). Pick WT mKate2+ and check for correct segregation of progeny to maintain. Derived by insertion of myo-2p::mKate2 transgene into hT2 balancer in parental strain KR2467 using CRISPR/Cas9. [NOTE: 3/1995: Apparently the lethal mutation is closely linked but not within the balanced region of hT2. It can occasionally recombine away so that the strain will segregate Bli-4 hT2 homozygotes. (Mark Edgley)]

umnIs67 [myo-2p::GFP + NeoR, I: 6284001 (intergenic)] III. Heterozygotes are WT GFP+ and segregate WT GFP+, DpyUnc, lethal GFP+ hT2 homozygotes (arrest stage unknown) and dead eggs (aneuploids). Will throw an occasional GFP+ Dpy non-Unc (similar events were observed in the parental hT2 strain). Pick WT GFP+ and check for correct segregation of progeny to maintain. Derived by insertion of myo-2p::GFP transgene into hT2 balancer in parental strain KR2467 using CRISPR/Cas9. [NOTE: 3/1995: Apparently the lethal mutation is closely linked but not within the balanced region of hT2. It can occasionally recombine away so that the strain will segregate Bli-4 hT2 homozygotes. (Mark Edgley)]

umnIs73 [myo-2p::mKate2 + NeoR, III: 9421936 (intergenic)] I. Heterozygotes are WT mKate2+ and segregate WT mKate2+, DpyUnc, lethal mKate2+ hT2 homozygotes (arrest stage unknown) and dead eggs (aneuploids). Will throw an occasional mKate+ Dpy non-Unc (similar events were observed in the parental hT2 strain). Pick WT mKate2+ and check for correct segregation of progeny to maintain. Derived by insertion of myo-2p::mKate2 transgene into hT2 balancer in parental strain KR2467 using CRISPR/Cas9. [NOTE: 3/1995: Apparently the lethal mutation is closely linked but not within the balanced region of hT2. It can occasionally recombine away so that the strain will segregate Bli-4 hT2 homozygotes. (Mark Edgley)]

Heterozygotes are WT and GFP+. Segregate non-GFP steriles (q145 homozygotes). qIs48 is an insertion of ccEx9747 with markers: myo-2::GFP expressed brightly in the pharynx throughout development, pes-10::GFP expressed in embryos, and a gut promoter driving GFP in the intestine, and is homozygous lethal.

Heterozygotes are WT and GFP+. Segregate syp-3(ok758) homozygotes that are non-GFP and lay mostly dead eggs; these mutants lack synaptonemal complex formation during meiosis. Homozygous hT2[bli-4 let-? qIs48] animals are inviable.

C07H6.5. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok492 homozygotes (sterile adult, tends to explode at vulva). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GGCAGCTCGAAAATATTGCC. External right primer: GGAAAACCGCAAGGATGGTGG. Internal left primer: TCACGGAGCTAGATGTGACG. Internal right primer: CGTCAAAAAGAACCCGATGT. Internal WT amplicon: 3095 bp. Deletion size: 1043 bp. Deletion left flank: GAGAACATACACAATCTGGACGAGATCACT. Deletion right flank: CCTGGGGTGGCGATGACCAAGTGAACCGTT. This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. URL: http://www.celeganskoconsortium.omrf.org.

tm1086 is homozygous lethal. Maternally rescued. Fails to produce viable progeny due to a defect in repairing meiotic DNA double-strand breaks. Chromosomes are visibly aggregated at diakinesis. Maintain by picking GFP progeny and checking that the non-GFP progeny that are produced fail to give viable progeny. qIs48 is an insertion of ccEx9747 with markers: myo-2::GFP expressed brightly in the pharynx throughout development, pes-10::GFP expressed in embryos, and a gut promoter driving GFP in the intestine, and is homozygous lethal.

Maintain by picking wild-type GFP+. Heterozygotes are WT GFP+ and should segregate WT GFP+ heterozygotes, non-GFP gsp-2 homozygotes (embryonic lethal), very rare GFP+ homozygous hT2, and dead eggs. hT2[qIs48] animals are recessive lethal. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype. Attribution: This strain was generated by the National Bioresource Project at the Tokyo Women's Medical University School of Medicine, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Heterozygotes are WT and GFP+, and segregate Sterile non-GFP (homozygous ar232) and dead eggs. ar232 have severely reduced germline proliferation.

nuIs175 [myo-2p::RFP + unc-129p::RFP::snb-1] X. smn-1 heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP rt248 homozygotes (larval arrest). Homozygous hT2 [bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. NOTE: myo-2p::RFP is not visible in this strain. rt248 is a 8 bp deletion in smn-1. [rt248: TTTTGATTAGC--------ATCCCAAAC] [wild-type: TTTTGATTAGCTCCGTATCATCCCAAAC] Reference: Dimitriadi M, et al. Proc Natl Acad Sci U S A. 2016 Jul 26;113(30):E4377-86. O'Hern PJ, et al. Elife. 2017 May 2;6. pii: e20752.

rtSi10 [smn-1p::smn-1 + Cbr-unc-119(+)] IV. nuIs175 [myo-2p::RFP + unc-129p::RFP::snb-1] X. rtSi10 transgene partially rescues smn-1(ok355): smn-1 homozygotes normally arrest as larvae, but somatic defects, including late larval lethality, are ameliorated by rtSi10. Sterility in smn-1(ok355) homozygotes is not rescued by rtSi10. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok355 homozygotes (sterile due to partial rescue by rtSi10). Homozygous hT2[bli-4 let-? qIs48] inviable. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype. Pick WT GFP and check for correct segregation of progeny to maintain. Reference: O'Hern PJ, et al. eLife 2017;6:e20752 doi: 10.7554/eLife.20752

Heterozygtes are WT. Hets segregate WT, UncBli and DpyLet. ct42 homozygotes are inviable at all temperatures (recessive non-conditional larval lethal). ct42 is dominant temperature sensitive maternal effect lethal. ct42 hets give more inviable progeny at 25C than at 15C. dch-1 was previously called let-354(ct42).

Heterozygotes are green and segregate green WT, dead eggs and nonGreens that lay dead eggs with the defects in spindle organization, chromosome segregation, and cytokinesis.