mom-2(or85) is a recessive, non-conditional maternal-effect embryonic lethal. Strong allele; missense mutation near N-terminus: L77P. 85% of mutant embryos lack gut. Heterozygotes are Unc. [NOTE: (08-27-2014) We have been informed that the mutation carried in this strain is the same molecular lesion as or77. We are working to determine if or85 and or77 are in fact the same lesion or if an incorrect genotype was provided for the strain.]

Maintain at 15C. Animals are Unc.

Heterozygotes are Unc and lay 10/16 dead embryos. spn-4 homozygotes look WT but are non-conditional maternal effect embryonic lethals. Embryos from homozygous mothers exhibit defects in mitotic spindle orientation and cell fate patterning.

Heterozygotes are WT and segregate WT, Dpys and dead eggs. Dpys segregate only embryonic lethals which lack endoderm and make excess mesoderm with E adopting and MS-like fate. or42 is a recessive maternal-effect lethal.

Heterozygotes are Unc and segregate Unc, WT which give only dead eggs, and dead eggs. Maintain by picking Unc.

Heterozygotes are WT and segregate WT, Uncs and Rollers. or78 zygotic effects: Pv, mild Unc, many explode at vulva upon reaching adulthood. or78 maternal effects: endoderm (E) transformed into mesoderm (MS) in early embryo, severe morphogenesis defect. mig-14, mom-3, pvl-2, and let-553 are the same gene.

Heterozygotes are Unc and segregate Unc, WT which give only dead eggs, and dead eggs. Maintain by picking Unc.

Heterozygotes are WT. Segregates Uncs which give only embryonic lethals which lack gut and make excess mesoderm (E adopts an MS-like fate). or39 is a recessive maternal-effect embryonic lethal.

mom-2(or33) is a recessive, non-conditional maternal-effect embryonic lethal. Intermediate strength allele; missense mutation near C-terminus: C321Y. 50% of mutant embryos lack gut. Heterozygotes are Unc.

Heterozygotes are WT. Segregates Uncs which give only embryonic lethals which lack gut and make excess mesoderm (E adopts an MS-like fate). or11 is a recessive maternal-effect embryonic lethal.

Heterozygotes are WT. Segregates Uncs which give only embryonic lethals which lack gut and make excess mesoderm (E adopts an MS-like fate). or39 is a recessive maternal-effect embryonic lethal.

Heterozygotes are WT. Segregates Uncs which give only embryonic lethals which lack gut and make excess mesoderm (E adopts an MS-like fate). or39 is a recessive maternal-effect embryonic lethal. Throws males.

Heterozgyotes are WT and segregate WT, Uncs which give only dead eggs, and dead eggs.

Heterozygotes are WT and segregate WT and Uncs. The Uncs have a non-conditional maternal-effect embryonic lethal phenotype: the E blastomere adopts MS fate in about 5% of mutant embryos. The Uncs are 100% penetrant for embyronic lethality and morphogenesis defects.

Heterozygotes are WT and lay 10/16 dead eggs. spn-4 unc-42 homozygotes are Unc and lay dead embryos exhibiting defects in mitotic spindle orientation and cell fate patterning. spn-4(or25) homozygotes are non-conditional maternal effect embryonic lethal.

Heterozygotes are Unc and lay 10/16 dead embryos. spn-4 homozygotes look WT but are non-conditional maternal effect embryonic lethals. Embryos from homozygous mothers exhibit defects in mitotic spindle orientation and cell fate patterning.

Heterozygotes are WT and segregate WT, Uncs which give only dead eggs, and dead eggs.

Heterozygotes are Unc and segregate Uncs, WT which give only dead eggs, and dead eggs. or309 is a deletion allele: removes exon 4 to 3' end and leave about 100 N-terminal amino acids.

Heterozygotes are Unc and segregate Unc and wild type animals which give only dead progeny.

Heterozygotes are WT and segregate WT, Dpys which give only dead eggs and dead eggs.

Homozygous nearly sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ef15 homozygotes (pale, nearly sterile, lays few eggs). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Reference: Schmid M, et al. Genes Dev. 2009 Apr 1;23(7):824-36.

Homozygous nearly sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ef8 homozygotes (nearly sterile, lays few eggs). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Reference: Rybarska A, et al. PLoS Genet. 2009 May;5(5):e1000494.

Egl. Low penetrance embryonic lethal. mig-14, mom-3, pvl-2, and let-553 are the same gene.

Homozygous viable and fertile, but slow growing, transparent and small. Originally from BC4253 but outcrossed an additional 7 times.

Heterozygotes are WT and GFP+. tm1741 homozygotes are small and sterile. Pick GFP+ heterozygotes to maintain. qIs48 is an insertion of ccEx9747 with markers: myo-2::GFP expressed brightly in the pharynx throughout development, pes-10::GFP expressed in embryos, and a gut promoter driving GFP in the intestine, and is homozygous lethal. Reference: Wehman AM, et al. Curr Biol. 2011 Dec 6;21(23):1951-9.

Maintain by picking wild-type GFP+. Heterozygotes are WT GFP+ and should segregate WT GFP+ heterozygotes, non-GFP gsp-2 homozygotes (embryonic lethal), very rare GFP+ homozygous hT2, and dead eggs. hT2[qIs48] animals are recessive lethal. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype. Attribution: This strain was generated by the National Bioresource Project at the Tokyo Women's Medical University School of Medicine, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Heterozygotes are Unc and segregate Sterile non-Unc (homozygous for ar228) and dead eggs. ar228 have severely reduced germline proliferation, which is more severe at 15C than at 25C.

Heterozygotes are WT and GFP+, and segregate Sterile non-GFP (homozygous ar232) and dead eggs. ar232 have severely reduced germline proliferation.

naEx57 [lag-2p::FLP::let-858 3'UTR + ceh-22p::GFP]. Him. Derived by injection of plasmids pGC158 and pCW2.19. Reference: Voutov, R and Hubbard, EJ. Genetics 180(1):103-19 (2008).

naIs3 [(pGC133) hsp-16.41::FLP:::let-858 3'UTR) + Cbr-unc-119(+)].

naIs6 [hsp-16.2p::FLP::let-858 3'UTR + Cbr-unc-119(+) + ceh-22p::GFP)].

naEx75 [(pGC146) hsp-16.2p::FLP::let-858 3'UTR) + Cbr-unc-119(+) + (pCW2.1) ceh-22p::GFP)]. Array was bombarded but did not integrate.

naIs7 [hsp-16.2p::FLP::let-858 3'UTR + Cbr-unc-119(+)]. Does not express ceh-22p::GFP, but unc-119 is rescued.

Heterozygotes are WT and segregate WT, DpySteriles, and Uncs which give only dead eggs.

Heterozygotes are WT and segregate WT, DpySteriles, and Uncs which give only dead eggs.

Heterozygotes are WT and segregate WT, DpySteriles, and Uncs which give only dead eggs. t1440 previously called mel-27.

Heterozygotes are WT and segregate WT, DpySteriles and Uncs which give only dead eggs. This strain was mistakenly called emb-30 in the paper; it is not an emb-30 allele.

Heterozygotes are WT and segregate WT, DpySteriles, and Uncs which give only dead eggs.

Temperature sensitive. Maintain at 15C. See also CGC 1806.

Temperature sensitive. Maintain at 15C. No growth at 20C. See also CGC 1806.

Temperature sensitive. Maintain at 15C. See also WBPaper00001806.

Maternal effect temperature sensitive embryonic lethal. Leaky. Maintain at 15C. mett-10 was formerly known as let-42.

Homozygous sterile allele balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP sterile homozygotes (tm1310 is maternally rescued; progeny of non-GFP animals fail to give viable progeny). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Reference: Castellano-Pozo, García-Muse T, Aguilera A. 2012 R-loops cause replication impairment and genome instability during meiosis. EMBO Rep. 13(10): 923-9.

Maintain by picking Unc GFP progeny that produce viable embryos and checking that the non-GFP progeny that are produced fail to give viable progeny. tm1310 is a homozygous sterile allele balanced by bli-4- and GFP-marked translocation. Heterozygotes are Unc with pharyngeal GFP signal, and segregate Unc GFP, arrested hT2 aneuploids, and non-GFP sterile homozygotes (tm1310 is maternally rescued; progeny of non-GFP animals fail to give viable progeny). Homozygous hT2 [bli-4 let-? qIs48] inviable. ok79 heterozygotes are Unc and segregate Uncs, dead eggs, and Him ok79 homozygotes (maternally rescued). Reference: Castellano-Pozo, García-Muse T, Aguilera A. 2012 R-loops cause replication impairment and genome instability during meiosis. EMBO Rep. 13(10): 923-9.

Internal tag of EGL-19 at N-terminal side of exon 3 via CRISPR/Cas9 knock-in of mScarlet at egl-19 locus. Tags isoforms a and b. Insertion verified by PCR and fluorescence. Left flank: 5' ttatttgaatgagcaaaaaataaatttcag 3'; Right flank: 5' GCCGCAGTGGCAGCTTCATCATCACAAGAT 3’ (1 silent mutation); gRNA: TTGTGATGATGAAGCTGCCA; Cas9/sgRNA plasmid: pGLOW69; mScarlet^SEC^3xMyc plasmid: pGLOW60; SEC insertion allele strain (balanced): GLW52.

N-terminal tag of SOD-5 via CRISPR/Cas9 knock-in of mScarlet at sod-5 locus. Insertion verified by PCR and fluorescence. Left flank: 5' tgtgctaacgaaaattttactaaaaggaaa 3'; Right flank: 5' ATGGATATTCTCTCTGATATTGCAAATGCC 3’ (1 silent mutation); sgRNA: tacCTGTGGAAGAACGGCAT; Cas9/sgRNA plasmid: pGLOW122; mScarlet^SEC^3xMyc plasmid: pGLOW129; SEC insertion allele strain: GLW78.

N-terminal tag of PQE-1 via CRISPR/Cas9 knock-in of mScarlet at pqe-1 locus. Insertion verified by PCR and fluorescence. Genotyping primers: fwd – 5’ CCAGATGCGAAAGCGAACAG 3’ ; rev – 5’ TGTACTTACCGGAATCGGCG 3’. Left flank: 5' ttaataatcattccagcaagtatctcagcc 3'; Right flank: 5' ATGTTTAATGGCGGCTATGGATCTGGAAAC 3’; sgRNA: atctcagccATGTTTAATGG; Cas9/sgRNA plasmid: pGLOW143; mScarlet^SEC^3xMyc plasmid: pGLOW142; SEC insertion allele strain: GLW84.

N-terminal tag of UBQL-1 via CRISPR/Cas9 knock-in of mScarlet at ubql-1 locus. Insertion verified by PCR and fluorescence. Genotyping primers: fwd – 5’ AGGGCGAGAGATTATCGGGA 3’; rev – 5’ CGGATCGTTGAGAATGTGTCC 3’. Left flank: 5' gtcggttttttaatatttctcaaatttaag 3'; Right flank: 5' ATGGCTACAGAGAGTGCACTCATCAAAGTTCACGTGAAATCACCCT 3’ (7 silent mutations); sgRNA: TCAACGTCATACTTGTTCGA; Cas9/sgRNA plasmid: pGLOW134; mScarlet^SEC^3xMyc plasmid: pGLOW145; SEC insertion allele strain: GLW88.

C-terminal tag of HRPA-1 via CRISPR/Cas9 knock-in of mScarlet at hrpa-1 locus. Insertion verified by PCR and fluorescence. Genotyping primers: fwd – 5’ GTCTCCACCAAACGCCTGTA 3’ ; rev – 5’ CTAGCCTGTGTCCCATCAGC 3’. Left flank: 5' AATGGGCCCACGCCCAGGGAGGAAACAGAAACTAT 3' (5 silent mutations); Right flank: 5' TAAattaattccttaagcccctctaagtgt 3’; sgRNA: CAGTGGGCTCATGCTCAAGG; Cas9/sgRNA plasmid: pGLOW144; mScarlet^SEC^3xMyc plasmid: pGLOW153; SEC insertion allele strain: GLW90.