BC4882 |
C. elegans |
dpy-17(e164) let-799(s2852) ncl-1(e1865) unc-32(e189) III; sDp3 (III;f). Show Description
Maintain by picking Uncs.
|
|
BC4883 |
C. elegans |
let-831(s2853) dpy-17(e164) ncl-1(e1865) unc-32(e189) III; sDp3 (III;f). Show Description
Maintain by picking Uncs.
|
|
BC4997 |
C. elegans |
dpy-17(e164) let-755(s2861) unc-32(e189) III; sDp3 (III;f). Show Description
Maintain by picking Uncs. DpyUncs arrest at early-mid larval stages.
|
|
BC917 |
C. elegans |
let-61(s65) unc-22(s7)/+ + IV. Show Description
Heterozygotes are WT and segregate WT and Lethal Twitchers. Lethal late larval. Maintain by picking WT which throw Lethal Twitchers. Hets twitch in 1% Nicotine.
|
|
BC918 |
C. elegans |
let-63(s170) unc-22(s7)/+ + IV. Show Description
Heterozygotes are WT and segregate WT and Lethal Twitchers. Lethal mid larval. Maintain by picking WT which throw Lethal Twitchers. Hets twitch in 1% Nicotine.
|
|
BC933 |
C. elegans |
unc-22(s7) let-66(s176)/+ + IV. Show Description
Heterozygotes are WT and segregate WT and Lethal Twitchers. Lethal early larval. Heterozygotes twitch in 1% nicotine.
|
|
BC934 |
C. elegans |
let-59(s175) unc-22(s7)/+ + IV. Show Description
Heterozygotes are WT and segregate WT and dead eggs. Hets twitch in 1% nicotine. Maintain by picking Twitchers in 1% Nicotine.
|
|
BC954 |
C. elegans |
let-64(s216) unc-22(s7)/+ + IV. Show Description
Heterozygotes are WT (twitch in 1% nicotine) and segregate WT and thin, twitcher sterile adults. Pick twitchers in 1% nicotine to maintain.
|
|
BC964 |
C. elegans |
let-56(s46) unc-22(s7)/unc-5(e152) dpy-4(e1166) IV. Show Description
Heterozygotes are WT and segregate more WT, DpyUncs and Lethal Twitchers. Lethal late larval. Heterozygotes Twitch in 1% Nicotine. Pick WT to maintain.
|
|
BC965 |
C. elegans |
let-59(s49) unc-22(s7)/unc-5(e152) dpy-4(e1166) IV. Show Description
Heterozygotes are WT and segregate WT, DpyUnc and Lethal Twitchers. Lethal early larval. Hets twitch in 1% Nicotine. Pick WT to maintain.
|
|
BC966 |
C. elegans |
let-60(s59) unc-22(s7)/unc-5(e152) dpy-4(e1166) IV. Show Description
Heterozygotes are WT and segregate WT, DpyUnc, and Lethal Twitchers. Lethal mid-larval (leaky). Heterozygotes twitch in nicotine.
|
|
BC987 |
C. elegans |
unc-22(s7) let-52(s42)/+ + IV. Show Description
Heterozygotes are WT and segregate WT and Lethal Twitchers. Lethal early larval. Hets twitch in 1% Nicotine. Pick WT to maintain.
|
|
BN30 |
C. elegans |
npp-15(ok1954) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Heterozygotes are WT and GFP+. ok1954 homozygotes arrest as larvae. Pick GFP+ heterozygotes to maintain. qIs48 is an insertion of ccEx9747 with markers: myo-2::GFP expressed brightly in the pharynx throughout development, pes-10::GFP expressed in embryos, and a gut promoter driving GFP in the intestine, and is homozygous lethal. Reference: Rodenas E, et al. Mol Biol Cell. 2012 Mar;23(5):930-44.
|
|
BN358 |
C. elegans |
ima-2(ok256) I/hT2[bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP sterile homozygotes (produce only dead embryos). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Derived from strain XA3503. Reference: ima-2(ok256) is described in Askjaer et al., Mol Biol Cell. 2002 Dec;13(12):4355-70.
|
|
BN359 |
C. elegans |
ima-2(ok256) I/hT2[bli-4(e937) let-?(q782) qIs48] (I;III); qaIs3502. Show Description
qaIs3502 [pie-1p::YFP::lmn-1 + pie-1p::CFP::H2B + unc-119(+)]. Germline expression of YFP::lmn-1. CFP::HIS is silenced in qaIs3502. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP sterile homozygotes (produce only dead embryos). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Derived from strains XA3502 and XA3503. Reference: ima-2(ok256) is described in Askjaer et al., Mol Biol Cell. 2002 Dec;13(12):4355-70.
|
|
BN360 |
C. elegans |
ima-2(ok256) I/hT2[bli-4(e937) let-?(q782) qIs48] (I;III); qaIs3502; ojIs1. Show Description
ojIs1 [pie-1p::GFP::tbb-2 + unc-119(+)]. qaIs3502 [pie-1p::YFP::lmn-1 + pie-1p::CFP::H2B + unc-119(+)]. Germline expression of YFP::lmn-1. CFP::HIS is silenced in qaIs3502. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP sterile homozygotes (produce only dead embryos). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Derived from strains XA3502 and XA3503. Reference: ima-2(ok256) is described in Askjaer et al., Mol Biol Cell. 2002 Dec;13(12):4355-70.
|
|
BS3347 |
C. elegans |
lin-45(dx84) IV/nT1 [unc-?(n754) let-?] (IV;V). Show Description
Heterozygotes are Unc and segregate Unc heterozygotes, non-Unc Steriles (lin-45 homozygotes), larval lethals, and dead eggs. dx84 is a strong lin-45 raf allele: dx84 homozygotes from dx84/+ heterozygotes are 47% larval lethal and among the adults, 100% are Sterile and Vul.
|
|
BS5182 |
C. elegans |
sec-61.G(oz1) sma-1(e30) V/nT1 [unc-?(n754) let-?] (IV;V). Show Description
Heterozygotes are Unc and segregate Unc, dead eggs and Sma. sec-61.G sma-1 homozygotes grow up to be sterile adults, with endomitotic oocytes in the gonad arm. sec-61.G also known as emo-1.
|
|
BS5183 |
C. elegans |
lin-45(oz201) IV/nT1 [unc-?(n754) let-?] (IV;V). Show Description
Heterozygotes are Unc and segregate Unc, non-Unc Steriles, larval lethals, and dead eggs. oz201 is a strong lin-45 raf allele: oz201 homozygotes from oz201/+ heterozygotes segregate 55% larval lethal and the remaining adults are all Sterile and Vul.
|
|
BS5431 |
C. elegans |
prp-17(oz273) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Homozygous sterile mutation balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP sterile oz273 homozygotes. Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain.
|
|
BS5435 |
C. elegans |
prp-17(oz273) I/hT2 (I;III); glp-1(oz264) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
glp-1(oz264) is a gain-of-function allele. Homozygous sterile mutation balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP sterile oz273; oz264 homozygotes. Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain.
|
|
BW163 |
C. elegans |
ctDf1 V/nT1 [unc-?(n754) let-?] (IV;V). Show Description
Heterozygotes are Unc and segregate Uncs (heterozygotes) and dead eggs (ctDf1 homozygotes or nT1 homozygotes).
|
|
BW1747 |
C. elegans |
dpy-18(e364)/eT1 III; unc-46(e177) let-427(s1057)/eT1 V. Show Description
Heterozygotes are WT and segregate WT, Unc-36, Sterile DpyUncs and dead eggs. Maintain by picking WT.
|
|
CA1117 |
C. elegans |
dsb-1(we11) IV/nT1[unc-?(n754) let-?] (IV;V). Show Description
Heterozygotes are Unc and segregate Uncs, dead eggs, and non-Uncs (dsb-1 homozygotes), which produce 99% inviable embryos due to meiotic nondisjunction. Pick Unc to maintain and check for correct segregation of progeny. we11 is a TCA to TAA nonsense mutation in the dsb-1 coding sequence that introduces a premature stop after leucine 96. Reference: Stamper EL, et al. PLoS Genet. 2013;9(8):e1003679.
|
|
CA649 |
C. elegans |
ubc-9(tm2610) IV/nT1 [unc-?(n754) let-?] (IV;V). Show Description
Heterozygotes are Unc and segregate Uncs, dead eggs, and Pvul slow growing tm2610 homozygotes. Pick Unc to maintain and check for correct segregation of progeny. Reference: Bhalla N, et al. PLoS Genet. 2008 4(10) e1000235.
|
|
CB2779 |
C. elegans |
let-201(e1716) unc-54(e1092)/eDf24 I. Show Description
Heterozygotes are WT. eDf24 homozygotes arrest as early larvae. eDf24 = let(e2000).
|
|
CB2780 |
C. elegans |
let-203(e1717) unc-54(e1092)/eDf24 I. Show Description
Heterozygotes are WT. eDf24 homozygotes arrest as early larvae. eDf24 = let(e2000).
|
|
CB2781 |
C. elegans |
unc-54(e1092) let-208(e1718)/eDf24 I. Show Description
Heterozygotes are WT. eDf24 homozygotes arrest as early larvae. eDf24 = let(e2000).
|
|
CB2782 |
C. elegans |
let-204(e1719) unc-54(e1092)/eDf24 I. Show Description
Heterozygotes are WT. eDf24 homozygotes arrest as early larvae. eDf24 = let(e2000).
|
|
CB2784 |
C. elegans |
let-202(e1720) unc-54(e1092)/eDf24 I. Show Description
Heterozygotes are WT. eDf24 homozygotes arrest as early larvae. eDf24 = let(e2000).
|
|
CB2785 |
C. elegans |
let-206(e1721) unc-54(e1092)/eDf24 I. Show Description
Heterozygotes are WT. eDf24 homozygotes arrest as early larvae. eDf24 = let(e2000).
|
|
CB2786 |
C. elegans |
let-205(e1722) unc-54(e1092)/eDf24 I. Show Description
Heterozygotes are WT. eDf24 homozygotes arrest as early larvae. eDf24 = let(e2000).
|
|
CB2787 |
C. elegans |
let-207(e1723) unc-54(e1092)/eDf24 I. Show Description
Heterozygotes are WT. eDf24 homozygotes arrest as early larvae. eDf24 = let(e2000).
|
|
CB3313 |
C. elegans |
ect-2(e1778)/dpy-10(e128) II. Show Description
Poorly balanced. Hets are WT and segregate WT, Dpys and ect-2 homozygotes. ect-2 homozygotes are sterile Uncs which reach adulthood, sometimes giving polynucleate oocytes. ect-2 pka let-21.
|
|
CB3988 |
C. elegans |
tra-3(e1107) IV/nT1 [unc-?(n754) let-?] (IV;V). Show Description
Hets are Unc and segregate Unc, WT hermaphrodites and dead eggs. The WT hermaphrodites segregate only abnormal sterile males or intersexes. Maintain by picking Unc.
|
|
CB4883 |
C. elegans |
let-551(e2517)/dpy-21(e428) rol-9(sc148) V. Show Description
Heterozygotes are WT and segregate WT, Lethals (L2/L3 arrest at 20C, some survive to sterile adults at 15C), and DpyRol. Not balanced well: get recombinants. Must maintain by picking hets at each generation and check for proper segregants in F1.
|
|
CB5009 |
C. elegans |
let-552(e2542)/dpy-25(e817) II. Show Description
At 20C or 25C heterozygotes are semi-Dpy and segregate semi-Dpys (heterozygotes), Dpys (dpy-25/dpy-25) and animals which arrest as Dpyish young larvae (let-552/let-552). Maintain by picking semi-Dpy. At 15C it is difficult to distinguish between let-552 homozygotes and dpy-25 homozygotes (e817 is inviable at 15C).
|
|
CB5166 |
C. elegans |
dif-1(e2562) IV/nT1 [unc-?(n754) let-?] (IV;V). Show Description
Heterozygotes are Unc and segregate Uncs, dead eggs, and WT (dif-1/dif-1). The WT animals give 100% dead eggs. dif-1 is a maternal effect embryonic lethal gene and e2562 is a putative null allele.
|
|
CB5378 |
C. elegans |
unc-42(e270) let-560(e2658) V/nT1 (IV;V). Show Description
let-560(e2658) was a spontaneous mutation in strain DH424. let-560 homozygotes are late embryonic lethal. Strain segregates WT, Vul and dead eggs.
|
|
CB5535 |
C. elegans |
hda-1(e1795) V/nT1 [unc-?(n754) let-?] (IV;V). Show Description
Heterozygotes are Unc and segregate Unc, non-Unc Sterile Gon, and dead eggs.
|
|
CE1857 |
C. elegans |
ect-2(e1778)/unc-4(e120) sqt-1(sc13) II. Show Description
Heterozygotes are WT and segregate WT, Roller Uncs, and ect-2 homozygotes (sterile Uncs which reach adulthood, sometimes giving polynucleate oocytes). ect-2 pka let-21. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
CER123 |
C. elegans |
ham-3(he159) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I; III). Show Description
Heterozygotes are WT, GFP+ in the pharynx and segregate WT (GFP+ in the pharynx), dead eggs (homozygotes for hT2) and ham-3(he159) homozygotes, which are Sma, Egl, Adl, Pvl. Maintain by picking GFP+ worms and checking for correct segregation, since the hT2 balancer is lost at low frequencies. he159 allele was isolated by John Satterlee from a deletion library at Sander van den Heuvel's lab. Reference: Ertl I, et al. Genetics. 2016 Mar;202(3):961-75.
|
|
CF367 |
C. elegans |
mig-14(mu71) II. Show Description
QL descendants anterior, QR descendants slightly posterior to WT. HSN posterior (50%), BDU posterior (50%), DTCs make extra turns. Mild Egl. Male Mating: ME2. mig-14, mom-3, pvl-2, and let-553 are the same gene.
|
|
CGC128 |
C. elegans |
+/hT2 [umnIs15] I; dcr-1(pk1351)/hT2 [bli-4(e937) let-?(h661)] III. Show Description
umnIs15 [myo-2p::GFP + NeoR, III: 9421936 (intergenic)] I. Heterozygotes are WT GFP+ and segregate WT GFP+, dcr-1 homozygotes (protruding vulva, sterile/egl, rupture at vulva), lethal GFP+ hT2 homozygotes (arrest stage unknown) and dead eggs (aneuploids). Will throw an occasional GFP+ Pvul. Pick WT GFP+ and check for correct segregation of progeny to maintain. Derived from parental strains CGC26 and NL687. [NOTE: 3/1995: Apparently the lethal mutation is closely linked but not within the balanced region of hT2. It can occasionally recombine away so that the strain will segregate Bli-4 hT2 homozygotes. (Mark Edgley)]
|
|
CGC135 |
C. elegans |
let-7(umn45[let-7p::egl-13-NLS::mScarlet-I::c-myc-NLS::linker::mODC(422-461)(E428A/E430A/E431A)::let-858 3' UTR])/tmC24 [F23D12.4(tmIs1240) unc-9(tm9719)] X. Show Description
tmIs1240 [myo-2p::venus, X: F23D12.4] X. Nuclear mScarlet-I fused to a PEST was inserted in place of the endogenous let-7 pre-miRNA via CRISPR/CAS9. Heterozygotes are wild-type GFP+ mScarlet+ and segregate wild-type GFP+ mScarlet+ heterozygotes, mScarlet+ non-GFP dead larvae (umn45 homozygotes) and Mec(Unc) non-mScarlet GFP+ (tmC24 homozygotes). Maintain by picking wild-type GFP+ mScarlet+. Left Flanking: GCAAGCAGGCGATTGGTGGACGGTC, Right Flanking: AGCTGCGTCGTCTTGCTCTCACAAc. sgRNA: AAAATTGCATAGTTCACCGG.
|
|
CGC136 |
C. elegans |
mir-84(umn46[mir-84p+SL1::egl-13-NLS::mScarlet-I::c-myc-NLS::linker::mODC(422-461)(E428A/E430A/E431A)::let-858 3' UTR]) X. Show Description
Nuclear mScarlet-I fused to a PEST was inserted in place of the endogenous mir-84 pre-miRNA via CRISPR/CAS9. Left Flanking: GTTGAGACATGTATATGTTTTTGTT, Right Flanking: GCTACTATTCATCATACGTCTGCCT. sgRNA: ATTCATCATACGTCTGCCTG.
|
|
CGC137 |
C. elegans |
mir-241(umn47[mir-241p+SL1::egl-13-NLS::mScarlet-I::c-myc-NLS::linker::mODC(422-461)(E428A/E430A/E431A)::let-858 3' UTR]) V. Show Description
Nuclear mScarlet-I fused to a PEST was inserted in place of the endogenous mir-241 pre-miRNA via CRISPR/CAS9. Left Flanking: CTATTTTTTTCACTTGGATTAGGGG, Right Flanking: GGGATGCTCTTTTTGTACCAAACCG. sgRNA: CCTCAACTTTGACACCCCCG.
|
|
CGC152 |
C. elegans |
mir-48(umn59[mir-48p+SL1::EGL-13NLS::mScarlet-I::cMycNLS::Lox511I::let-858 3'UTR]) V. Show Description
Nuclear mScarlet-I was inserted in place of the endogenous mir-48 pre-miRNA via CRISPR/CAS9. Left Flanking: CACAGGTAAGTCAATTAACCAATTG, Right Flanking: TTATTATTATGTTTCATTCAATAAC. sgRNA: GGGAATGCGAGCTAGGCTGG.
|
|
CGC153 |
C. elegans |
mir-48(umn60[mir-48p+SL1::EGL-13NLS::mScarlet-I::cMycNLS::linker::mODC(422-461)(E428A/E430A/E431A):: lox511I::let-858 3'UTR]) V. Show Description
Nuclear mScarlet-I was inserted in place of the endogenous mir-48 pre-miRNA via CRISPR/CAS9. Left Flanking: CACAGGTAAGTCAATTAACCAATTG, Right Flanking: TTATTATTATGTTTCATTCAATAAC. sgRNA: GGGAATGCGAGCTAGGCTGG.
|
|
CGC159 |
C. elegans |
mir-61&mir-250(umn66[mir-61p::SL1::EGL-13NLS::lox2272::mScarlet-I::cMycNLS::Lox511I::let-858 3'UTR::lox2722]) II. Show Description
mScarlet replacement of mir-61 and mir-250 pre-miRNAs. SEC has been removed, leaving the SL1::EGL-13NLS::lox2272::mScarlet-I::cMycNLS::let-858 3'UTR transcriptional reporter in the locus
|
|