More Fields
Strain Species Genotype
WM182 C. elegans csr-1(tm892) IV/nT1 [unc-?(n754) let-?] (IV;V). Show Description
Heterozygotes are Unc. csr-1(tm892) homozygotes are non-Unc and Sterile.
WM214 C. elegans avr-14(ad1302) I; csr-1(tm892)/nT1 [unc-?(n754) let-?] IV; avr-15(ad1051) glc-1(pk54))/nT1 V; axIs36 X. Show Description
axIs36 [pes-10::GFP]. Heterozygotes are Unc and sensitive to ivermectin. Segregates csr-1 homozygotes (sterile, non-Unc, resisitant to ivermectin), dead embryos, and Unc heterozygotes. Maintain by picking Uncs. Do not distribute this strain; other labs should request it directly from the CGC. Reference: Claycomb JM, et al. Cell. 2009 Oct 2;139(1):123-34.
WM215 C. elegans avr-14(ad1302) ego-1(om97) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III); avr-15(ad1051) glc-1(pk54)) V. Show Description
Heterozygotes are wild-type, GFP+ and sensitive to ivermectin. Segregates non-GFP ego-1 homozygotes (sterile, resisitant to ivermectin), arrested hT2 aneuploids, and wild-type GFP+ heterozygotes. Maintain by picking GFP+. Do not distribute this strain; other labs should request it directly from the CGC. Reference: Claycomb JM, et al. Cell. 2009 Oct 2;139(1):123-34.
WM216 C. elegans avr-14(ad1302) drh-3(tm1217) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III); avr-15(ad1051) glc-1(pk54)) V. Show Description
Heterozygotes are wild-type, GFP+ and sensitive to ivermectin. Segregates non-GFP drh-3 homozygotes (sterile, resisitant to ivermectin), arrested hT2 aneuploids, and wild-type GFP+ heterozygotes. Maintain by picking GFP+. Do not distribute this strain; other labs should request it directly from the CGC. Reference: Claycomb JM, et al. Cell. 2009 Oct 2;139(1):123-34.
WM43 C. elegans gex-3(zu196) IV/nT1 [unc-?(n754) let-?] (IV;V). Show Description
Heterozygotes are Unc and segregate Unc, WT which give only dead eggs, and dead eggs. Zygotic phenotype: 100% of gex-3 homozygotes become Egl although they all make a normal looking L3/L4 vulva. Embryonic phenotype: complete loss of morphogenesis - hypodermal cells fail to intercalate or migrate. Received new stock from Erik Lundquist 11/2003.
WM65 C. elegans src-1(cj293) let-502(sb118)/hT1 I; +/hT1 V. Show Description
Heterozygotes are WT and segregate WT, Uncs that give dead embryos (src-1 homozygotes), dead eggs, and mid-larval lethals (hT1 homozygotes). src-1 is linked to an unknown Unc. [Feb 2005: Paul Mains has found a temperature-sensitive let-502 mutation (called sb118) linked to src-1 in this strain. Not sure if this is the Unc mutation mentioned here, or a third mutation on this chromosome.]
WS2265 C. elegans hus-1(op244) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Heterozygotes are WT GFP+ and segregate non-glowing hus-1 homozygotes and very rare homozygous hT2 glowing animals, and dead eggs. qIs48 is an insertion of ccEx9747 with markers: myo-2::GFP expressed brightly in the pharynx throughout development, pes-10::GFP expressed in embryos, and gut promoter driving GFP in the intestine. hus-1(op244) mutants from homozygous parents show an incompletely penetrant maternal effect embryonic lethality. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype.
WS4918 C. elegans opIs310. Show Description
opIs310 [ced-1p::YFP::act-5::let-858 3'UTR + unc-119(+)].
WS4920 C. elegans ced-2(n1994) IV; opIs310. Show Description
opIs310 [ced-1p::YFP::act-5::let-858 3'UTR + unc-119(+)].
WS5229 C. elegans unc-119(ed3) III; fan-1(tm423) IV; opIs406. Show Description
opIs406 [fan-1p::fan-1::GFP::let-858 3'UTR + unc-119(+)]. opIs406 resuces tm423. Reference: Kratz K, et al. Cell. 2010 Jul 9;142(1):77-88.
WU144 C. elegans lin-45(n1924) unc-24(e138) IV. Show Description
Weak lin-45 raf allele: 5% larval lethal. Otherwise, essentially WT vulval induction and fertility. n1924 effectively suppresses the let-60(n1046gf) Muv phenotype. Unc.
WU156 C. elegans lin-1(n2515) dpy-13(e184) IV. Show Description
n2515 suppresses the let-60(gf) Muv phenotype. Isolation of lin-1 causes no significant vulval defect; it is a missense mutation that changes Proline 384 to Leucine. dpy-13 is a linked marker.
WU51 C. elegans lin-45(n2520) unc-24(e138) IV. Show Description
Weak severity of lin-45 raf allele: WT viability, vulval induction and fertility but effectively suppresses the let-60(n1046gf) Muv phenotype. Unc.
WU53 C. elegans lin-45(n1925) unc-24(e138) IV. Show Description
Weak lin-45 raf allele: essentially WT viability, vulval induction and fertility but effectively suppresses the let-60(n1046gf) Muv phenotype. Unc.
WU684 C. elegans let-60(n1046) IV; cgr-1(am114) X. Show Description
Low penetrance Muv (<1%). Slow growing at 20C. 75% larval lethality at 15C. Maintain at 20C.
XA8400 C. elegans qaIs8400. Show Description
qaIs8400 [let-858p::Ov-GST-3 + rol-6(su1006)]. Called AK1 in the reference article. The Ov-GST-3 gene was amplified from genomic DNA of O. volvulus with 1µM of the sequence specific primer 5'Klon and 3'Klon (5'Klon: 5'-GGCGTACGATGTCAAGATTTCCTCAACAAG-3'; 3'Klon: 5'-GGTCTAGATTTATTTAGGAATGATTGAATCGGTCG-3'; representing bases 4 - 25 and the complementary sequence of bases 821 - 841 of the published Ov-GST-3 cDNA (AF203814); bold underlines indicate restriction sites for Pfl23II (SplI) and XbaI, respectively; dotted underline indicates the start codon for translation; italics indicates the conserved sequence for the polyadenylation signal for transgenic transcript processing; the 8 5'-nucleotides of primer 3'Klon and the fourteen 5'-nucleotides of primer 5'Klon do not correspond to the template and introduce the sequences to the amplicon), 200 µM of each deoxynucleotide (Gibco BRL) and 2.5 units of Taq polymerase (Gibco BRL). After an initial denaturation of 3 minutes at 93°C, 35 cycles of annealing at 55°C for 1 minute, synthesis at 72°C for 2 minutes and a 1 minute denaturation at 93°C were performed, followed by a final extension at 72°C for 5 minutes. The genomic Ov-GST-3 fragment obtained by PCR (see above) was ligated into the pGEM-T Easy vector (Promega) by TA-cloning, cleaved with the restriction enzymes Pfl23II (SplI) and XbaI (restriction sites introduced by the primer) and inserted between the unique Pfl23II (SplI) and XbaI sites of the vector pPD103.05 (kindly provided by A. Fire). The sequence of the genomic Ov-GST-3 fragment in the resulting plasmid pAK1 was confirmed by automated dye terminator, dideoxy sequencing (ABI Prism 377TM Sequencer, PE Applied Biosystems) using the PCR primers (see above). The pAK1 DNA was injected in combination with the marker plasmid pRF4 [rol-6(su1006)] into the gonads of N2 C. elegans at a concentration of approximately 100 ng/µl for each plasmid. Transgenic worms were identified by the selectable Roller marker phenotype and the stable transmitting line AK1ex (AK1 extrachromosomal) was established. Integration of the extrachromosomal arrays was achieved by irradiation of AK1ex worms with 3600 rad (1 rad = 0.01 Gy) of x-rays (x-ray chamber: RUM 9421-070-77002, Philips, Netherlands; dosimeter: PTW-SN4, PTW, Germany). The progeny of these worms was then screened for 100% transmittance of the Roller phenotype to obtain the C. elegans line AK1int (AK1 integrated) with the chromosomally integrated transgenes.
XK194 C. elegans unc-46(e177) let-479(s1576) V/nT1 [qIs51] (IV;V). Show Description
XM1007 C. elegans fog-3(q443) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III); unc-43(n498) IV. Show Description
Heterozygotes are Unc with pharyngeal GFP signal. Homozygous hT2[bli-4 let-? qIs48] are inviable. Homozygous unc-43(n498); fog-3(q443) animals are females.
YG1007 C. elegans baf-1(gk324) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III); syIs50. Show Description
syIs50 [cdh-3::GFP + dpy-20(+)]. Heterozygotes are WT and GFP+, and segregate arrested hT2 aneuploids, non-GFP gk324 homozygotes (Sterile and Unc). All worms express cdh-3::GFP at the anchor cell. qIs48 is an insertion of ccEx9747 with markers: myo-2::GFP expressed brightly in the pharynx throughout development, pes-10::GFP expressed in embryos, and a gut promoter driving GFP in the intestine, and is homozygous lethal.
YG1011 C. elegans baf-1(gk324) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III); qIs19 V. Show Description
qIs19 [lag-2p::GFP::unc-54 3'UTR + rol-6(su1006)] V. Heterozygotes are Rollers with pharyngeal GFP signal, and segregate arrested hT2 aneuploids, and non-GFP gk324 homozygotes (Sterile and Unc). All worms express lag-2p::GFP at the distal tip cells. qIs48 is an insertion of ccEx9747 with markers: myo-2::GFP expressed brightly in the pharynx throughout development, pes-10::GFP expressed in embryos, and a gut promoter driving GFP in the intestine, and is homozygous lethal.
YG1017 C. elegans baf-1(gk324) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III); syIs78. Show Description
syIs78 [ajm-1::GFP + unc-119(+)] is probably on LG I (not on II, III, V or X). Heterozygotes are WT and GFP+, and segregate arrested hT2 aneuploids, non-GFP gk324 homozygotes (Sterile, Roller and Unc). All worms express ajm-1::GFP (Junction Associated Protein). qIs48 is an insertion of ccEx9747 with markers: myo-2::GFP expressed brightly in the pharynx throughout development, pes-10::GFP expressed in embryos, and a gut promoter driving GFP in the intestine, and is homozygous lethal.
YG1021 C. elegans baf-1(gk324) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III); ccIs4810 X. Show Description
ccIs4810 [(pJKL380.4) lmn-1p::lmn-1::GFP::lmn-1 3'utr + (pMH86) dpy-20(+)] X. Heterozygotes are WT with pharyngeal GFP signal, and segregate arrested hT2 aneuploids, non-GFP gk324 homozygotes (Sterile and Unc). All worms express Cel-lamin::GFP (lmn-1 gene is expressed at the nuclear periphery). qIs48 is an insertion of ccEx9747 with markers: myo-2::GFP expressed brightly in the pharynx throughout development, pes-10::GFP expressed in embryos, and a gut promoter driving GFP in the intestine, and is homozygous lethal.
YG1036 C. elegans baf-1(gk324) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III); zzIs16. Show Description
zzIs16 [(pJE3) eff-1::GFP + rol-6(su1006)]. Heterozygotes are Rollers with pharyngeal GFP signal, and segregate arrested hT2 aneuploids, and non-GFP gk324 homozygotes (Sterile, Roller and Unc). All worms express GFP driven by eff-1 promoter. qIs48 is an insertion of ccEx9747 with markers: myo-2::GFP expressed brightly in the pharynx throughout development, pes-10::GFP expressed in embryos, and a gut promoter driving GFP in the intestine, and is homozygous lethal.
YG1046 C. elegans baf-1(gk324) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III); eff-1(ok1021) II; syIs78. Show Description
syIs78 [ajm-1::GFP + unc-119(+)] is probably on LG I (not on II, III, V or X). Heterozygotes are slow-growing DpyUnc with cell fusion problems and pharyngeal GFP signal. Segregates arrested hT2 aneuploids, and non-GFP DpyUnc gk324 homozygotes (Sterile, Dpy and Unc). All worms express ajm-1::GFP(Junction Associated Protein). qIs48 is an insertion of ccEx9747 with markers: myo-2::GFP expressed brightly in the pharynx throughout development, pes-10::GFP expressed in embryos, and a gut promoter driving GFP in the intestine, and is homozygous lethal.
YHS2 C. elegans cdc-25.1(bn115) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Homozygous sterile deletion balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP bn115 homozygotes (sterile). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Reference: Kim J, et al. (2009) Mol Cell 28:43-8.
YL651 C. elegans let-607(tm1423) I; unc-119(ed3) III; vrIs121. Show Description
vrIs121 [let-607(fosmid)::GFP + unc-119(+)]. let-607 locus in fosmid tagged at the carboxy-terminus with GFP. Derived by crossing the LET-607::GFP transgenic strain (YL529) to let-607(tm1423) mutants. vrIs121 transgene rescues the lethal mutant phenotype of let-607(tm1423) homozygous mutants. Reference: Weicksel SE, et al. Development. 2016 Oct 1;143(19):3540-3548.
ZT2 C. elegans drh-3(fj52) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Heterozygotes are WT. drh-3 homozygotes are sterile. the fj52 mutation deletes a 405 bp region including the promoter, the first exon and half of the second exon. The deletion can be checked by PCR with the following primers: TTTATTGATTCCGCCGTTGCTC and TGCAGCTCCAGCCACTCTATCA. The fj52 mutation was isolated from a deletion mutant libray of the K. Nishiwaki group. Homozygous hT2[bli-4 let-? qIs48] inviable.