| LW905 |
C. elegans |
lmn-1(tm1502) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP tm1502 homozygotes (sterile). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain.
|
|
| MG827 |
C. elegans |
unc-119(ed3) III; xsSi36 IV. Show Description
xsSi36 [myo-2p::GFP(Y66C)::let-858 3'UTR + Cbr-unc-119(+) IV:13,048,924]. This strain contains a non-fluorescent GFP that can be used to enrich for CRISPR mediated, oligodirected homologous recombination. [NOTE: previously published as mgSi36.] Reference: Zhang D & Glotzer M. 2014. Efficient site-specific editing of the C. elegans genome. doi: http://dx.doi.org/10.1101/007344.
|
|
| MH1019 |
C. elegans |
soc-2(ku167) IV. Show Description
No obvious phenotype alone. ku167 suppresses let-60(n1046). Previously called sur-8.
|
|
| MH1131 |
C. elegans |
soc-2(ku167) let-60(n1046) IV. Show Description
Less than 5% Muv. Previously called sur-8(ku167).
|
|
| MH17 |
C. elegans |
sur-2(ku9) I. Show Description
100% bag of worms. Low percentage of dead larvae. Slightly dumpy. ku9 completely suppresses let-60(n1046) Muv phenotype.
|
|
| MH2285 |
C. elegans |
lin-66(ku423) IV/nT1 [unc-?(n754) let-?] (IV;V). Show Description
Heterozygotes are Unc. ku423 homozygotes have delayed heterochronic phenotype and are L4 lethal.
|
|
| MH231 |
C. elegans |
let-60(n1046) IV; ksr-1(ku68) X. Show Description
Semi-dominant suppressor of let-60(n1046). Strong reduction of function mutation. At 20C: <1% Muv, 24% Egl, 6% larval lethal, and SM migration defects.
|
|
| MH2430 |
C. elegans |
cbp-1(ku258) III. Show Description
Semidominant suppressor of let-60(n1046).
|
|
| MH351 |
C. elegans |
let-60(sy101sy127)/dpy-20(e1282) IV. Show Description
Heterozygotes are WT and segregate WT, Dpys and lethals.
|
|
| MH538 |
C. elegans |
mek-2(ku114) I; let-60(n1046) IV. Show Description
|
|
| MH801 |
C. elegans |
sur-7(ku119) X. Show Description
No obvious morphological phenotype on its own. Good suppressor of Muv of let-60(n1046).
|
|
| ML2501 |
C. elegans |
let-805(mc73[let-805::gfp + unc-119(+)]) unc-119(ed3) III. Show Description
Superficially wild-type. mc73 was generated by using Crispr/Cas9 to add a GFP tag to the endogenous let-805 locus and also insert a rescuing unc-119 transgene. Reference: Quentin S, et al. Development 2016 143: 160-173; doi: 10.1242/dev.126615.
|
|
| ML2578 |
C. elegans |
let-4(mc95[let-4::GFP]) X. Show Description
GFP tag inserted into endogenous let-4 locus using CRISPR/Cas9. Reference: Vuong-Brender TTK, et al. Development. 2017 Dec 1;144(23):4336-4349. doi: 10.1242/dev.150383. PMID: 28526752.
|
|
| MLC1480 |
C. elegans |
lucIs39. Show Description
lucIs39 [tbx-37p::mNeonGreen::2xNLS::tbx-37 3'UTR + pal-1p::mScarlet-I::2xNLS::tbb-2 3'UTR + med-2p::mScarlet-I::2xNLS::tbb-2 3'UTR]. Wild-type morphology. Integrated array allows for labeling and sorting of ABa and ABp descendants by FACS. Reference: Charest J, et al. Dev Cell. 2020 Sep 24;S1534-5807(20)30672-9. PMID: 33002421
|
|
| MLC2230 |
C. elegans |
vha-1(luc161) III/hT2[bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Heterozygotes are wild-type with pharyngeal GFP signal, and segregate wild-type GFP, arrested hT2 aneuploids, and non-GFP luc161 homozygotes (embryonic lethal). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick wild-type GFP and check for correct segregation of progeny to maintain. vha-1(luc161) is a 454 bp deletion removing most of the coding sequence. Reference: Gutie?rrez-Pérez, P. et al. A deeply conserved miR-1 dependent regulon supports muscle cell physiology. bioRxiv, 2020, doi.org/10.1101/2020.08.31.275644.
|
|
| MSB1041 |
C. elegans |
bus-17(br2) X; mirIs92. Show Description
mirIs92 [daf-16p::daf-16::GcNL::let-858 3'UTR + myo-2p::mCherry]. bus-17(br2) has defective response to short wavelength light; response strongly reduced but not eliminated. Altered surface properties; somewhat skiddy movement; drug-sensitive, bleach-sensitive. Resistant to some bacterial pathogens (hence Bus, Bah phenotypes) and hypersensitive to others. daf-16 translational reporter with green non-calcium sensitive nanolantern (GCNL). Reference: Morales-Curiel LF, et al. Commun Biol. 2022 Dec 3;5(1):1330. doi: 10.1038/s42003-022-04292-x. PMID: Reference: Morales-Curiel LF, et al. Commun Biol. 2022 Dec 3;5(1):1330. doi: 10.1038/s42003-022-04292-x. PMID: 36463346.
|
|
| MSB273 |
C elegans |
syIs423 V; mirIs19. Show Description
syIs423 [15xUAS::?pes-10::GCaMP6s::SL2::mKate2::let-858 3'UTR + myo-2p::NLS::mCherry + 1kb DNA ladder(NEB)]. mirIs19 [nlp-12p::gal-4 + unc-122p::mCherry]. Maintain animals at 25C for several generations to enhance mKate expression in DVA to make it visible with a fluorescence dissection scope. Reference: Das R, et al. Sci Adv. 2021 Sep 17;7(38):eabg4617. doi: 10.1126/sciadv.abg4617. PMID: 34533987
|
|
| MSB555 |
C elegans |
twk-16(syb2541[wrmScarlet::degron::twk-16]) X. Show Description
wrmScarlet::degron tag inserted into the N-terminus of the endogenous twk-16 locus using CRISPR. wScarlet::TWK-16 expression in DVA and some neurons around the nerve ring. Reference: Das R, et al. Sci Adv. 2021 Sep 17;7(38):eabg4617. doi: 10.1126/sciadv.abg4617. PMID: 34533987
|
|
| MSB861 |
C. elegans |
mirSi16 II; mirIs76; mirEx69. Show Description
mirSi16 [flp-18p::lox2272::BFP::tbb-2 3'UTR::lox2272::ChR2-HRDC::SL2::jRGECO1a::unc-54 3'UTR + Cbr-unc-119(+)] II. mirIs76 [sra-6p::ChRmine::wrmScarlet::let-858 3UTR + sra-6p::TeNL]. mirEx69 [gpa:14p::CRE + unc-122p::mCherry]. Mantain by picking animals with mCherry+ coelomycetes. Blue in flp-18 expressing neurons. Expression of ChRmine, wrmScarlet and calcium sensitive (Kd 250 nM) teal nanolantern (TeNL) in ASH and PVQ. Expression of ChR2-HRDC and jRGECO1a expression in AVA (instead of BFP). Reference: Porta-de-la-Riva M, et al. Nat Methods. 2023 May;20(5):761-769. doi: 10.1038/s41592-023-01836-9. PMID: 37024651.
|
|
| MSB952 |
C. elegans |
mirIs97 [*oxTi677] II; unc-119(ed3) III. Show Description
mirIs97 [15XUAS::ACR1::let-858 3'UTR *oxTi677 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]] II. Superficially wildtype. Integration of multicopy UAS::ACR1 array into tdTomato in the oxTi677 insertion. Genotype for UAS::ACR1 with primers 5'-atgagcagcatcacctgtgat-3' and 5'-ttaggtctcgccggctct-3' to obtain a ~900 bp band.
|
|
| MSB961 |
C. elegans |
mirSi29 II; unc-119(ed3) III. Show Description
mirSi29 [flp-18p::lox2272::mtagBFP2::tbb-2 3'UTR::lox2272::ACR1::SL2::jRGECO1a::let-858 3'UTR + Cbr-unc-119(+)] II. Blue fluorescence in flp-18 expressing neurons. Combine with CRE driven by a promoter co-expressed in flp-18 expressing cells to switch from blue expression to ACR1 and jRGECO1a expression. Reference: Porta-de-la-Riva M, et al. Nat Methods. 2023 May;20(5):761-769. doi: 10.1038/s41592-023-01836-9. PMID: 37024651.
|
|
| MSB966 |
C. elegans |
mirSi34 II; unc-119(ed3) III. Show Description
mirSi34 [myo-3p::lox2272::mtagBFP2::tbb-2 3'UTR::lox2272::ChR2-HRDC::SL2::jRGECO1a::let-858 3'UTR + Cbr-unc-119(+)] II. Blue fluorescence in body wall muscles. Combine with CRE driven by a promoter expressed in desired muscle cells to switch from blue expression to ChR2-HRDC and jRGECO1a expression. Reference: Porta-de-la-Riva M, et al. Nat Methods. 2023 May;20(5):761-769. doi: 10.1038/s41592-023-01836-9. PMID: 37024651.
|
|
| MSB985 |
C. elegans |
mirSi37 II; unc-119(ed3) III. Show Description
mirSi37 [flp-18p::lox2272::mtagBFP2::tbb-2 3'UTR::lox2272::ChRmine::SL2::jRGECO1a::let-858 3'UTR + Cbr-unc-119(+)] II. Blue fluorescence in flp-18 expressing neurons. Combine with CRE driven by a promoter co-expressed in flp-18 expressing cells to switch from blue expression to ChRmine and jRGECO1a expression. Reference: Porta-de-la-Riva M, et al. Nat Methods. 2023 May;20(5):761-769. doi: 10.1038/s41592-023-01836-9. PMID: 37024651.
|
|
| MT10996 |
C. elegans |
sqv-5(n3611)/hT2 I; +/hT2 [bli-4(e937) let-?(h661)] III. Show Description
Heterozygotes are WT and segregate WT, Sqv Mel, and dead eggs.
|
|
| MT11713 |
C. elegans |
mep-1(n3702) IV/nT1 [unc-?(n754) let-?] (IV;V). Show Description
Heterozygotes are Unc and segregate Unc, PvlSte, and dead eggs.
|
|
| MT12755 |
C. elegans |
ceh-32(ok343) V/nT1 [unc-?(n754) let-?] (IV;V). Show Description
Heterozygotes are Unc. ok343 is lethal or has a linked lethal.
|
|
| MT13516 |
C. elegans |
isw-1(n4066) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP n4066 homozygotes (sterile). n4066 is a deletion of F37A4.8.
|
|
| MT14171 |
C. elegans |
met-1(n4337) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III); met-2(n4256) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
n4256 is a deletion of R05D3.11 (met-2). n4337 is a deletion of C43E11.3 from the splice donor for the 4th exon through exon 7. Heterozygotes are WT with pharyngeal GFP signal. Homozygous hT2[bli-4 let-? qIs48] are inviable.
|
|
| MT14390 |
C. elegans |
let-418(n3536) V. Show Description
Temperature sensitive allele of let-418. Viable at 20C. Sterile and partially Muv at 22.5C. Larval lethal at 25C.
|
|
| MT14728 |
C. elegans |
mfap-1(n4564 n5214) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP mfap-1 homozygotes. Pick WT GFP and check for correct segregation of progeny to maintain. mfap-1(n4564 n5214) mutants exhibit temperature-sensitive lethality: at 15°C, (n4564 n5214) homozygous animals grow and behave similarly to wild-type; at 20°C mutant animals grow more slowly, have few progeny and are hyperactive; at 25°C the mutant strain is embryonically lethal. qIs48 is an insertion of ccEx9747 (carries myo-2::GFP, pes-10::GFP, and a gut enhancer fused to GFP) onto the hT2 chromosome and is homozygous lethal. Reference: Ma L, et al. PLoS Genet. 2012;8(7):e1002827.
|
|
| MT15080 |
C. elegans |
sup-17(n1306) unc-29(e1072) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Heterozygotes are WT and GFP+. hT2[qIs48] animals are recessive lethal. n1306 is recessive late larval lethal. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype.
|
|
| MT15081 |
C. elegans |
sup-17(n1315) unc-29(e1072) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Heterozygotes are WT and GFP+. hT2[qIs48] animals are recessive lethal. n1315 is recessive lethal. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype.
|
|
| MT15082 |
C. elegans |
sup-17(n1318) unc-29(e1072) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Heterozygotes are WT and GFP+. hT2[qIs48] animals are recessive lethal. n1318 is recessive lethal. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype.
|
|
| MT15083 |
C. elegans |
sup-17(n1319) unc-29(e1072) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Heterozygotes are WT and GFP+. hT2[qIs48] animals are recessive lethal. n1319 is recessive lethal. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype.
|
|
| MT15084 |
C. elegans |
sup-17(n1320) unc-29(e1072) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Heterozygotes are WT and GFP+. hT2[qIs48] animals are recessive lethal. n1320 is recessive lethal. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype.
|
|
| MT15107 |
C. elegans |
lin-53(n3368) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Homozygous lethal deletion balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP n3368 homozygotes. Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain.Class B SynMuv, Ste, Pvul. Reference: Harrison MM, Ceol CJ, Lu X, Horvitz HR. PNAS. 2006 Nov 7;103(45):16782-7.
|
|
| MT15606 |
C. elegans |
met-2(n4256) hpl-2(tm1489) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Heterozygotes are WT and GFP+. qIs48 [myo-2::GFP + pes-10::GFP + ges-1::GFP]. Homozygous hT2 animals are inviable. May have lin-15A(n767) in background.
|
|
| MT1679 |
C. elegans |
unc-105(n490) II; lon-2(e678) let-2(n821) X. Show Description
Long. n821 pka sup-20(n821).
|
|
| MT1720 |
C. elegans |
unc-105(n490) II; let-2(n821) X. Show Description
n490sd: curly Unc, Sma. n821: WT revertant of n490; extragenic; pka sup-20. See Science 273: 361-364 1996.
|
|
| MT17463 |
C. elegans |
set-25(n5021) III. Show Description
Contained background Let mutation that was lost during outcrossing. Reference: Development 134(16):2991-9 (2007).
|
|
| MT1821 |
C. elegans |
lin-25(e1446) V/nT1 [unc-?(n754) let-?] (IV;V). Show Description
Hets are Unc and segregate Unc, Vul and dead eggs. Maintain by picking Uncs.
|
|
| MT19085 |
C. elegans |
hlh-2(n5287) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP n5287 homozygotes (embryonic lethal). Homozygous hT2 [bli-4 let-? qIs48] inviable. Pick wild-type GFP and check for correct segregation of progeny to maintain. n5287 is a 2,694 bp deletion (flanking seq 5' - TGCAACTGCCGCCATTGCTC 3' - AAAACTCTCTAGCATATTGT) and 25 bp insertion (TCTGCCATCATTGCTGCCATTGCTC). Reference: Nakano S, Ellis RE, Horvitz HR. Development. 2010 Dec;137(23):4017-27.
|
|
| MT20110 |
C. elegans |
unc-4(e120) rol-1(e91)/mnC1 [dpy-10(e128) unc-52(e444) nIs190 let-?] II. Show Description
nIs190 [myo-2::GFP] integrated in or near mnC1. Approx 0.5% recombination seen between nIs190 and mnC1. Fails to complemement all markers on mnC1. Heterozygotes are WT. Segregates WT GFP+ and Egl Unc Rol; no Dpy Uncs are seen as nIs190 mnC1 homozygotes are embryonic lethal.
|
|
| MT20111 |
C. elegans |
unc-4(e120) bli-1(e769)/mnC1 [dpy-10(e128) unc-52(e444) nIs190 let-?] II. Show Description
nIs190 [myo-2::GFP] integrated in or near mnC1. Approx 0.5% recombination seen between nIs190 and mnC1. Fails to complemement all markers on mnC1. Heterozygotes are WT. Segregates WT GFP+ and Egl Unc Bli; no Dpy Uncs are seen as nIs190 mnC1 homozygotes are embryonic lethal.
|
|
| MT20187 |
C. elegans |
rba-1(n5418) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Pick wild-type GFP+ to maintain. Heterozygotes are wild-type GFP+ and segregate WT green-glowing heterozygotes and non-glowing rba-1 homozygotes. rba-1(n5418) homozygotes are sterile or produce eggs that fail to hatch. qIs48 is an insertion of ccEx9747 (carries myo-2::GFP, pes-10::GFP, and a gut enhancer fused to GFP) onto the hT2 chromosome and is homozygous lethal. Reference: Nakano S, Stillman B, Horvitz HR. Cell. 2011 December 23; 147(7): 1525-1536.
|
|
| MT20434 |
C. elegans |
chaf-1(n5453) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Heterozygotes are WT and GFP+ in the pharynx. qIs48 is an insertion of ccEx9747 (carries myo-2::GFP, pes-10::GFP, and a gut enhancer fused to GFP) onto the hT2 chromosome and is homozygous lethal. Presence of ces-1 is inferred from strain construction but not experimentally verified. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype. Reference: Nakano S, et al. Cell. 2011 Dec 23;147(7):1525-36.
|
|
| MT2123 |
C. elegans |
let-23(n1045) II. Show Description
Homozygous viable. Vulvaless. Cold Sensitive.
|
|
| MT2124 |
C. elegans |
let-60(n1046) IV. Show Description
Non-lethal let-60 allele, multivulva phenotype (93% penetrance). Semi-Dominant (17% of hets are Muv). Amber suppressible. Non-null. PKA lin-34. See WBPaper00006902: strain probably carries a side mutation(s) that impairs chemotaxis to the odorant isoamyl alcohol.
|
|
| MT2718 |
C. elegans |
let-2(n1279) unc-3(e151) X; mnDp26 (X;f). Show Description
n1279 is lethal. Animals which are alive contain the duplication. n1279 pka sup-20.
|
|
| MT3025 |
C. elegans |
let-23(n1045) II; lin-13(n387) unc-36(e251)/unc-32(e189) III. Show Description
Heterozygotes are Vulvaless and segregate more Vul, Vul Unc-36 and Vul Unc-32. n1045 is cold sensitive-strain gives some arrested larvae (L2) which look like little sticks.
|
|