syIs423 [15xUAS::?pes-10::GCaMP6s::SL2::mKate2::let-858 3'UTR + myo-2p::NLS::mCherry + 1kb DNA ladder(NEB)]. mirIs19 [nlp-12p::gal-4 + unc-122p::mCherry]. Maintain animals at 25C for several generations to enhance mKate expression in DVA to make it visible with a fluorescence dissection scope. Reference: Das R, et al. Sci Adv. 2021 Sep 17;7(38):eabg4617. doi: 10.1126/sciadv.abg4617. PMID: 34533987

wrmScarlet::degron tag inserted into the N-terminus of the endogenous twk-16 locus using CRISPR. wScarlet::TWK-16 expression in DVA and some neurons around the nerve ring. Reference: Das R, et al. Sci Adv. 2021 Sep 17;7(38):eabg4617. doi: 10.1126/sciadv.abg4617. PMID: 34533987

mirSi16 [flp-18p::lox2272::BFP::tbb-2 3'UTR::lox2272::ChR2-HRDC::SL2::jRGECO1a::unc-54 3'UTR + Cbr-unc-119(+)] II. mirIs76 [sra-6p::ChRmine::wrmScarlet::let-858 3UTR + sra-6p::TeNL]. mirEx69 [gpa:14p::CRE + unc-122p::mCherry]. Mantain by picking animals with mCherry+ coelomycetes. Blue in flp-18 expressing neurons. Expression of ChRmine, wrmScarlet and calcium sensitive (Kd 250 nM) teal nanolantern (TeNL) in ASH and PVQ. Expression of ChR2-HRDC and jRGECO1a expression in AVA (instead of BFP). Reference: Porta-de-la-Riva M, et al. Nat Methods. 2023 May;20(5):761-769. doi: 10.1038/s41592-023-01836-9. PMID: 37024651.

mirIs97 [15XUAS::ACR1::let-858 3'UTR *oxTi677 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]] II. Superficially wildtype. Integration of multicopy UAS::ACR1 array into tdTomato in the oxTi677 insertion. Genotype for UAS::ACR1 with primers 5'-atgagcagcatcacctgtgat-3' and 5'-ttaggtctcgccggctct-3' to obtain a ~900 bp band.

mirSi29 [flp-18p::lox2272::mtagBFP2::tbb-2 3'UTR::lox2272::ACR1::SL2::jRGECO1a::let-858 3'UTR + Cbr-unc-119(+)] II. Blue fluorescence in flp-18 expressing neurons. Combine with CRE driven by a promoter co-expressed in flp-18 expressing cells to switch from blue expression to ACR1 and jRGECO1a expression. Reference: Porta-de-la-Riva M, et al. Nat Methods. 2023 May;20(5):761-769. doi: 10.1038/s41592-023-01836-9. PMID: 37024651.

mirSi34 [myo-3p::lox2272::mtagBFP2::tbb-2 3'UTR::lox2272::ChR2-HRDC::SL2::jRGECO1a::let-858 3'UTR + Cbr-unc-119(+)] II. Blue fluorescence in body wall muscles. Combine with CRE driven by a promoter expressed in desired muscle cells to switch from blue expression to ChR2-HRDC and jRGECO1a expression. Reference: Porta-de-la-Riva M, et al. Nat Methods. 2023 May;20(5):761-769. doi: 10.1038/s41592-023-01836-9. PMID: 37024651.

mirSi37 [flp-18p::lox2272::mtagBFP2::tbb-2 3'UTR::lox2272::ChRmine::SL2::jRGECO1a::let-858 3'UTR + Cbr-unc-119(+)] II. Blue fluorescence in flp-18 expressing neurons. Combine with CRE driven by a promoter co-expressed in flp-18 expressing cells to switch from blue expression to ChRmine and jRGECO1a expression. Reference: Porta-de-la-Riva M, et al. Nat Methods. 2023 May;20(5):761-769. doi: 10.1038/s41592-023-01836-9. PMID: 37024651.

Heterozygotes are WT and segregate WT, Sqv Mel, and dead eggs.

Heterozygotes are Unc and segregate Unc, PvlSte, and dead eggs.

Heterozygotes are Unc. ok343 is lethal or has a linked lethal.

Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP n4066 homozygotes (sterile). n4066 is a deletion of F37A4.8.

n4256 is a deletion of R05D3.11 (met-2). n4337 is a deletion of C43E11.3 from the splice donor for the 4th exon through exon 7. Heterozygotes are WT with pharyngeal GFP signal. Homozygous hT2[bli-4 let-? qIs48] are inviable.

Temperature sensitive allele of let-418. Viable at 20C. Sterile and partially Muv at 22.5C. Larval lethal at 25C.

Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP mfap-1 homozygotes. Pick WT GFP and check for correct segregation of progeny to maintain. mfap-1(n4564 n5214) mutants exhibit temperature-sensitive lethality: at 15°C, (n4564 n5214) homozygous animals grow and behave similarly to wild-type; at 20°C mutant animals grow more slowly, have few progeny and are hyperactive; at 25°C the mutant strain is embryonically lethal. qIs48 is an insertion of ccEx9747 (carries myo-2::GFP, pes-10::GFP, and a gut enhancer fused to GFP) onto the hT2 chromosome and is homozygous lethal. Reference: Ma L, et al. PLoS Genet. 2012;8(7):e1002827.

Heterozygotes are WT and GFP+. hT2[qIs48] animals are recessive lethal. n1306 is recessive late larval lethal. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype.

Heterozygotes are WT and GFP+. hT2[qIs48] animals are recessive lethal. n1315 is recessive lethal. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype.

Heterozygotes are WT and GFP+. hT2[qIs48] animals are recessive lethal. n1318 is recessive lethal. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype.

Heterozygotes are WT and GFP+. hT2[qIs48] animals are recessive lethal. n1319 is recessive lethal. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype.

Heterozygotes are WT and GFP+. hT2[qIs48] animals are recessive lethal. n1320 is recessive lethal. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype.

Homozygous lethal deletion balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP n3368 homozygotes. Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain.Class B SynMuv, Ste, Pvul. Reference: Harrison MM, Ceol CJ, Lu X, Horvitz HR. PNAS. 2006 Nov 7;103(45):16782-7.

Heterozygotes are WT and GFP+. qIs48 [myo-2::GFP + pes-10::GFP + ges-1::GFP]. Homozygous hT2 animals are inviable. May have lin-15A(n767) in background.

Long. n821 pka sup-20(n821).

n490sd: curly Unc, Sma. n821: WT revertant of n490; extragenic; pka sup-20. See Science 273: 361-364 1996.

Contained background Let mutation that was lost during outcrossing. Reference: Development 134(16):2991-9 (2007).

Hets are Unc and segregate Unc, Vul and dead eggs. Maintain by picking Uncs.

Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP n5287 homozygotes (embryonic lethal). Homozygous hT2 [bli-4 let-? qIs48] inviable. Pick wild-type GFP and check for correct segregation of progeny to maintain. n5287 is a 2,694 bp deletion (flanking seq 5' - TGCAACTGCCGCCATTGCTC 3' - AAAACTCTCTAGCATATTGT) and 25 bp insertion (TCTGCCATCATTGCTGCCATTGCTC). Reference: Nakano S, Ellis RE, Horvitz HR. Development. 2010 Dec;137(23):4017-27.

nIs190 [myo-2::GFP] integrated in or near mnC1. Approx 0.5% recombination seen between nIs190 and mnC1. Fails to complemement all markers on mnC1. Heterozygotes are WT. Segregates WT GFP+ and Egl Unc Rol; no Dpy Uncs are seen as nIs190 mnC1 homozygotes are embryonic lethal.

nIs190 [myo-2::GFP] integrated in or near mnC1. Approx 0.5% recombination seen between nIs190 and mnC1. Fails to complemement all markers on mnC1. Heterozygotes are WT. Segregates WT GFP+ and Egl Unc Bli; no Dpy Uncs are seen as nIs190 mnC1 homozygotes are embryonic lethal.

Pick wild-type GFP+ to maintain. Heterozygotes are wild-type GFP+ and segregate WT green-glowing heterozygotes and non-glowing rba-1 homozygotes. rba-1(n5418) homozygotes are sterile or produce eggs that fail to hatch. qIs48 is an insertion of ccEx9747 (carries myo-2::GFP, pes-10::GFP, and a gut enhancer fused to GFP) onto the hT2 chromosome and is homozygous lethal. Reference: Nakano S, Stillman B, Horvitz HR. Cell. 2011 December 23; 147(7): 1525-1536.

Heterozygotes are WT and GFP+ in the pharynx. qIs48 is an insertion of ccEx9747 (carries myo-2::GFP, pes-10::GFP, and a gut enhancer fused to GFP) onto the hT2 chromosome and is homozygous lethal. Presence of ces-1 is inferred from strain construction but not experimentally verified. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype. Reference: Nakano S, et al. Cell. 2011 Dec 23;147(7):1525-36.

Homozygous viable. Vulvaless. Cold Sensitive.

Non-lethal let-60 allele, multivulva phenotype (93% penetrance). Semi-Dominant (17% of hets are Muv). Amber suppressible. Non-null. PKA lin-34. See WBPaper00006902: strain probably carries a side mutation(s) that impairs chemotaxis to the odorant isoamyl alcohol.

n1279 is lethal. Animals which are alive contain the duplication. n1279 pka sup-20.

Heterozygotes are Vulvaless and segregate more Vul, Vul Unc-36 and Vul Unc-32. n1045 is cold sensitive-strain gives some arrested larvae (L2) which look like little sticks.

Temperature sensitive Muv. Temperature sensitive lethal above 20C.

Unc. Muv (sd, gf).

Heterozygotes are WT and segregate WT, MuvUnc (n1046 e66) and n1531 homozygotes whose phenotypes range from a few dead larva to sterile adults. The normal larval lethality of n1531/n1531 is suppressed by the maternal contribution of n1046. n1046 is semi-dominant.

Heterozygotes are WT and segregate WT and dead eggs.

Heterozygotes are WT and segregate WT, Lethal Twitchers and dead eggs. Lethal mid-larval; some twitchers make it to almost adults but are always sterile. Maintain by picking WT.

Muv.

Heterozygotes are mostly non-Muv (about 20% will be Muv because n1700 is semi-dominant) and non-Unc. Hets segregate Twitchers which die at various larval stages or as Vul adults, because of the maternal effect rescue of n1531 by n1700. The Twitchers will not give viable progeny. Hets also segregate DpyMuvs. The strain segregates males which will mate, though not very well.

Dpy (ts). Muv (sd, gf).

n2031 homozygotes are dead. n2031/dpy-20 unc-22 animals are Vul (27%) or WT (73%).

Lethal suppressor of lin-15(n765).

Unc. n2018 is cold sensitive. Most animals at 15C are Vul/Let. AT 25C, 25% of the animals are non-Vul.

Non-Lethal allele of let-60. Clear. Suppresses n765. Maintain at 15C.

Heterozygotes are WT and segregate WT, Lethal twitchers and dead eggs.

Unc. nDf41 is homozygous lethal. Throws dead eggs.

Heterozygotes are Unc and segregate Unc, Vul and dead eggs.