Unc-13 phenotype. Segregates Uncs and lethal DpyUncs. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to Ann Rose.

Animals with the duplication are Unc. Animals which have lost the duplication are DpyUnc and arrest as Sterile adults.

Animals with the duplication are Unc. Animals which have lost the duplication are DpyUnc and arrest as Sterile adults.

Animals with the duplication are Unc. Animals which have lost the duplication are DpyUnc and arrest in early larval development.

Animals with the duplication are Unc. Animals which have lost the duplication are DpyUnc and arrest in mid larval development.

Unc-13 phenotype. Segregates Uncs and lethal DpyUncs (h392 arrests as a mid-stage larva). Pick Unc-13 animals to maintain. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to Ann Rose.

Unc-13 phenotype. h402 arrests as an embryo. Pick Unc-13 animals to maintain. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to Ann Rose.

Animals with the duplication are Unc. Animals which have lost the duplication are DpyUnc and arrest in early/mid larval development.

Animals with the duplication are Unc. Animals which have lost the duplication are DpyUnc and arrest in early larval development.

Animals with the duplication are Unc. Animals which have lost the duplication arrest in embyronic development.

Animals with the Dup are Unc. Animals which have lost the Dup are DpyUncLet and arrest in early larval development. Maintain by picking Unc.

Unc-13 phenotype. Segregates Uncs and lethal DpyUncs. h442 arrests as an early larva. Maintain by picking Unc-13 and checking for correct segregation of progeny.

Animals with the duplication are Unc. Animals which have lost the duplication are DpyUnc and arrest in early larval development.

Animals with the duplication are Unc. Animals which have lost the duplication are DpyUnc and arrest in late larval development.

Animals with the duplication are Unc. Animals which have lost the duplication are DpyUnc and arrest in late larval development.

Animals with the duplication are Unc. Animals which have lost the duplication are Dpy Unc and arrest in early mid development.

Animals with the duplication are Unc. Animals which have lost the duplication are DpyUnc and arrest in early larval development.

Animals with the duplication are Unc. Animals which have lost the duplication are DpyUnc and arrest in early larval development.

Animals with the duplication are Unc. Animals which have lost the duplication are DpyUnc and arrest in early larval development.

Animals with the duplication are Unc. Animals which have lost the duplication are DpyUnc and arrest in egg/early larval development.

Animals with the duplication are Unc. Animals which have lost the duplication are DpyUnc and arrest in late larval development.

Animals with the duplication are Unc. Animals which have lost the duplication are DpyUnc and arrest in early larval development.

Animals with the duplication are Unc. Animals which have lost the duplication are Dpy Unc and arrest in early mid development.

Segregates WT green-glowing heterozygotes and non-glowing cdk-9 homozygotes (arrest as L1-L2 larvae). qIs48 is an insertion of ccEx9747 (carries myo-2::GFP, pes-10::GFP, and a gut enhancer fused to GFP) onto the hT2 chromosome and is homozygous lethal. Reference: Bowman EA, et al. Development. (In Press).

ckSi12 [cdk-9(D235N)::mCherry + unc-119(+)] II. Segregates WT green-glowing heterozygotes and non-glowing cdk-9 homozygotes (arrest as L1-L2 larvae). qIs48 is an insertion of ccEx9747 (carries myo-2::GFP, pes-10::GFP, and a gut enhancer fused to GFP) onto the hT2 chromosome and is homozygous lethal. Reference: Bowman EA, et al. Development. (In Press).

ckSi21 [cdk-9::mCherry::pal-1 3'UTR + unc-119(+)] II. mCherry is expressed in all somatic nuclei; expressed in germline only at end of oogenesis. hT2 segregates WT green-glowing heterozygotes and non-GFP cdk-9 homozygotes (normally arrest as L1-L2 larvae; cdk-9 homozygotes carrying ckSi21 (GFP- mCherry+) are viable but sterile. qIs48 is an insertion of ccEx9747 (carries myo-2::GFP, pes-10::GFP, and a gut enhancer fused to GFP) onto the hT2 chromosome and is homozygous lethal. Reference: Bowman EA, et al. Development. (In Press).

ldEx9 [skn-1(operon)::GFP + rol-6(su1006)]. Maintain by picking Rollers. Reference: Tullet JM, et al. Cell. 2008 Mar 21;132(6):1025-38.

Sterile. Gonad & rachis defects. Grow at 20 C.

Heterozygotes are Unc and segregate Unc, dead eggs and arrested larvae. Published as LL1008. Previously known as daf-21.

mNG reporter inserted into endogenous unc-94b locus. m-Scarlet-I reporter inserted into endogenous cap-1 locus. Reference: Zhang P, et al. 2023 Sep 4;222(9):e202302102. doi: 10.1083/jcb.202302102. PMID: 37351566.

xchEx91 [hsp-16.2p::ssSel1::FLAG::superfolderGFP::spacer::humanAmyloidBeta1-42(F20S/L35P)::let-858 3’UTR + rol-6(su1006)]. Maintain at 15C. Pick Rollers to maintain. Control strain for LSD2104. Upon heat shock, non-sticky form of human amyloid beta is expressed and secreted into the extracellular space. Reference: Jongsma E, et al. eLife. 2023 Sep 20;12:e83465. doi: 10.7554/eLife.83465. PMID: 37728486. [NOTE: The temperature-sensitive allele cc546 causes an M1957L change in SMG-1. The lesion is an atg>ttg transversion in exon 35. Flanking sequences follow with the mutation site indicated with a capital A: ttggtggtcggttacaaaacgatattcaaga tcactggcagtcatgagtAtggttggatcagttttaggactcggtgatcg acatttggacaatttattg The lesion is detectable via SNP-snip with the mutation causing loss of an MslI site. Primers are for a 323 bp product. Digest with MslI to 86+237 in the wild type, uncut as 323 in the mutant. DJR701(f): CAGTCGTGAGCTTTGGATGCGTGC DJR702(r): TCGGGGATACGCAGATTCTTTCCC. Pedone ... Reiner G3 (2021).]

xchEx97 [hsp-16.2p::ssSel1::FLAG::superfolderGFP::spacer::let-858 3’UTR + rol-6(su1006)]. Maintain at 15C. Pick Rollers to maintain. GFP-only control strain for LSD2104. Upon heat shock, GFP is expressed and secreted into the extracellular space. Generated in PD8120 background. Reference: Jongsma E, et al. eLife. 2023 Sep 20;12:e83465. doi: 10.7554/eLife.83465. PMID: 37728486. [NOTE: The temperature-sensitive allele cc546 causes an M1957L change in SMG-1. The lesion is an atg>ttg transversion in exon 35. Flanking sequences follow with the mutation site indicated with a capital A: ttggtggtcggttacaaaacgatattcaaga tcactggcagtcatgagtAtggttggatcagttttaggactcggtgatcg acatttggacaatttattg The lesion is detectable via SNP-snip with the mutation causing loss of an MslI site. Primers are for a 323 bp product. Digest with MslI to 86+237 in the wild type, uncut as 323 in the mutant. DJR701(f): CAGTCGTGAGCTTTGGATGCGTGC DJR702(r): TCGGGGATACGCAGATTCTTTCCC. Pedone ... Reiner G3 (2021).]

xchIs15 [hsp-16.2p::ssSel1::FLAG::superfolderGFP::spacer::humanAmyloidBeta1-42::let-858 3’UTR + rol-6(su1006)]. Maintain at 15C: Prone to transgene suppression at higher temperatures. Rollers. Upon heat shock, human amyloid beta is expressed and secreted into the extracellular space. Aggregates are found in the extracellular space after 16 hours. Generated in N2 background. Reference: Jongsma E, et al. eLife. 2023 Sep 20;12:e83465. doi: 10.7554/eLife.83465. PMID: 37728486.

Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP tm1502 homozygotes (sterile). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain.

xsSi36 [myo-2p::GFP(Y66C)::let-858 3'UTR + Cbr-unc-119(+) IV:13,048,924]. This strain contains a non-fluorescent GFP that can be used to enrich for CRISPR mediated, oligodirected homologous recombination. [NOTE: previously published as mgSi36.]  Reference: Zhang D & Glotzer M. 2014. Efficient site-specific editing of the C. elegans genome. doi: http://dx.doi.org/10.1101/007344.

No obvious phenotype alone. ku167 suppresses let-60(n1046). Previously called sur-8.

Less than 5% Muv. Previously called sur-8(ku167).

100% bag of worms. Low percentage of dead larvae. Slightly dumpy. ku9 completely suppresses let-60(n1046) Muv phenotype.

Heterozygotes are Unc. ku423 homozygotes have delayed heterochronic phenotype and are L4 lethal.

Semi-dominant suppressor of let-60(n1046). Strong reduction of function mutation. At 20C: <1% Muv, 24% Egl, 6% larval lethal, and SM migration defects.

Semidominant suppressor of let-60(n1046).

Heterozygotes are WT and segregate WT, Dpys and lethals.

No obvious morphological phenotype on its own. Good suppressor of Muv of let-60(n1046).

Superficially wild-type. mc73 was generated by using Crispr/Cas9 to add a GFP tag to the endogenous let-805 locus and also insert a rescuing unc-119 transgene. Reference: Quentin S, et al. Development 2016 143: 160-173; doi: 10.1242/dev.126615.

lucIs39 [tbx-37p::mNeonGreen::2xNLS::tbx-37 3'UTR + pal-1p::mScarlet-I::2xNLS::tbb-2 3'UTR + med-2p::mScarlet-I::2xNLS::tbb-2 3'UTR]. Wild-type morphology. Integrated array allows for labeling and sorting of ABa and ABp descendants by FACS. Reference: Charest J, et al. Dev Cell. 2020 Sep 24;S1534-5807(20)30672-9. PMID: 33002421

Heterozygotes are wild-type with pharyngeal GFP signal, and segregate wild-type GFP, arrested hT2 aneuploids, and non-GFP luc161 homozygotes (embryonic lethal). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick wild-type GFP and check for correct segregation of progeny to maintain. vha-1(luc161) is a 454 bp deletion removing most of the coding sequence. Reference: Gutie?rrez-Pérez, P. et al. A deeply conserved miR-1 dependent regulon supports muscle cell physiology. bioRxiv, 2020, doi.org/10.1101/2020.08.31.275644.

mirIs92 [daf-16p::daf-16::GcNL::let-858 3'UTR + myo-2p::mCherry]. bus-17(br2) has defective response to short wavelength light; response strongly reduced but not eliminated. Altered surface properties; somewhat skiddy movement; drug-sensitive, bleach-sensitive. Resistant to some bacterial pathogens (hence Bus, Bah phenotypes) and hypersensitive to others. daf-16 translational reporter with green non-calcium sensitive nanolantern (GCNL). Reference: Morales-Curiel LF, et al. Commun Biol. 2022 Dec 3;5(1):1330. doi: 10.1038/s42003-022-04292-x. PMID: Reference: Morales-Curiel LF, et al. Commun Biol. 2022 Dec 3;5(1):1330. doi: 10.1038/s42003-022-04292-x. PMID: 36463346.