| VC4514 |
C. elegans |
erd-2.2(gk5585[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) III. Show Description
Homozygous viable. Deletion of 1316 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: TTTTAGGGTCATCATGAACATCTTCCGTAT; Right flanking sequence: ATATCCATTTATTCAGCTTTTTAAAATAGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VC4515 |
C. elegans |
rga-4(gk5586[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) V. Show Description
Homozygous viable. Deletion of 9831 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: AATGAAAATGAAGGATGGAATGAGAGGAAG. Right flanking sequence: TTTAGTGATTTTAAATTCGATTTTAAAATA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VC4516 |
C. elegans |
skat-1(gk5587[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) III. Show Description
Homozygous viable. Deletion of 1851 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: GTGATGGAATGATCGAAAAAAGTGAGAAAA. Right flanking sequence: AGGTCTGAAAATAAATATATATTAAACATA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VC4517 |
C. elegans |
scvp-1(gk5588[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) V. Show Description
Homozygous viable. Deletion of 619 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: GAACAGCATATGAAAGTTCATTTGAGTGCT. Right flanking sequence: AGCCATGACTATACATCAAACTGGTAATGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VC4518 |
C. elegans |
zgpa-1(gk5589[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) IV. Show Description
Homozygous viable. Deletion of 1815 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: ATACGTGTCTGAAATGTTTACATCAGGGTG. Right flanking sequence: GATGTATCGTCAATTTCAGCTGAATCTTCA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VC4519 |
C. elegans |
stt-3(gk5590[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ III. Show Description
Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 2794 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: TTTCTCTTTTCAGGTAATGACATCAACAAC. Right flanking sequence: TAAGGTTTTAAAGATTCCCACCTTTAATTT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VC4520 |
C. elegans |
col-125(gk5591[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ IV. Show Description
Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 1102 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: CTTTTTGTGTTGCCAAGGCTAGGTATCTTT. Right flanking sequence: GGGCTAAATGTTTAAAAGAAAGAAACACTG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VC4521 |
C. elegans |
tgn-38(gk5592[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) IV. Show Description
Homozygous viable. Deletion of 2607 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: GCCAACATTCCGATTCTATCGGCCCCGCCT. Right flanking sequence: GTCGGTAGTACGAACGGAGAACTAGAAAAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VC4522 |
C. elegans |
zak-1(gk5593[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) III. Show Description
Homozygous viable. Deletion of 3780 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TATAATTAAAAAAGGAAGATCTTGATCAAG. Right flanking sequence: TGCCTATCGGTGCTGAATTTGTAAAATACA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VC4523 |
C. elegans |
srn-1(gk5594[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) V. Show Description
Homozygous viable. Deletion of 2026 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TTTTGGACAGTTGGGTGTCAGATACCCGAC. Right flanking sequence: GAGCTACTACATCTTTAAAAGTCAAGTAAC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VC4524 |
C. elegans |
suca-1(gk5595[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) X. Show Description
Homozygous viable. Deletion of 2459 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: CTTCACATTATCTTAATTTTATTACCACGT. Right flanking sequence: ATTTCTGTGAGGTGTTGAGGAGCGGCTGAC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VC4525 |
C. elegans |
sth-1(gk5596[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) V. Show Description
Homozygous viable. Deletion of 2442 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: AACTAGCAAATCTCATTAGGTCTCCCGTCG. Right flanking sequence: GCGCGCCAATGTAAACTTAACAATGAAATC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VC4526 |
C. elegans |
xpb-1(gk5597[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) III. Show Description
Homozygous viable. Deletion of 7745 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TACCTACAAAGCAGAAGAAGCTCCATCATT. Right flanking sequence: TTGTCGTCCCGTTTGAAAAAGCACTTACGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VC4528 |
C. elegans |
prp-38(gk5599[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ V. Show Description
Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 1360 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: TTTTTGGAAAGTGGGTGACAAGTCGATGTG. Right flanking sequence: TGCGGTTTGCCATCTGAATTTTTAATTTAT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VC4529 |
C. elegans |
eif-2Bepsilon(gk5600[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ II. Show Description
[NOTE: Please see RG5013 for balanced version of this strain.] Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 2890 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: AAAATTTTGCAGATGCAATGACGCCCTACC. Right flanking sequence: CTTGTTATGACTGAAAGTTTTCAACCACTT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VC4530 |
C. elegans |
D2089.3(gk5601[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) II. Show Description
Homozygous viable. Deletion of 2409 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: AATTAGATTGACGAAAACAGGTATTTGACG. Right flanking sequence: ACCGGAAATACGTAGATATAACACGAAAAT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VC4531 |
C. elegans |
suox-1(gk5602[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ X. Show Description
Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 2222 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: AGATGAGACGATGTCAGAGAAGAAATTGGA. Right flanking sequence: ATAGAGTTCCCATTATTGTGAAGGATTAAG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VC4532 |
C. elegans |
tdpt-1(gk5603[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) I. Show Description
Homozygous viable. Deletion of 3196 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TTTTTATTTGTCTCTTCGCTTTTACCTCAT. Right flanking sequence: TTGCAATCCTGGCACGCGTGTTGCAACTGC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VC4533 |
C. elegans |
D2024.5(gk5604[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) IV. Show Description
Homozygous viable. Deletion of 897 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: AAGCGACTGAATGGAGAATTATTATGACAA. Right flanking sequence: TGAGGTTTTGCATCTGAATTTTCTTCAATT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VC4534 |
C. elegans |
pdxk-1(gk5605[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ I. Show Description
Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 2333 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: TACATACATATGGATTAAAGGGGACCCAGA. Right flanking sequence: CGAGGAAGGACCTGCTTTGGCCGCCAACGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VC4535 |
C. elegans |
eif-3.F(gk5606[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ II. Show Description
[NOTE: Please see RG5014 for balanced version of this strain.] Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 1569 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: GGCTTCGAATTTAACTGTCAATGTCCACCC. Right flanking sequence: CCCTCCCGAATTTGAAATTAGCGTTTCCAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VC4537 |
C. elegans |
thk-1(gk5608[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) IV. Show Description
Homozygous viable. Deletion of 1893 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: AAGTATTTAGATAAGACATTAAGTCCGAGC. Right flanking sequence: CAGTTAGTTGGATCTGGAATTATTGCTAGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VC4538 |
C. elegans |
sss-1(gk5609[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) IV. Show Description
Homozygous viable. Deletion of 1256 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: AGTTATAGAGAGAGGTTTAGAGAGAGAGCA. Right flanking sequence: AGGTTTAAGGTTTAAAAAATGCGACAAAGACATTTTTTGGACAATATTCT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VC4539 |
C. elegans |
nola-3(gk5610[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ I. Show Description
[NOTE: Please see RG5022 for balanced version of this strain.] Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 433 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: AGCTACTCAGCACGTGCCTATTATCCTCAC. Right flanking sequence: GCTGGTTTGGGAGTGGCGCCGCATGTTGCG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VC4540 |
C. elegans |
qns-1(gk5611[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ IV. Show Description
[NOTE: Please see RG5001 for balanced version of this strain.] Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 4093 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: GATAACTGAAATCTGGATAGAGGAATGGTC. Right flanking sequence: CCCAATTGTTGACTGTACATGTGGCAACGC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VC4541 |
C. elegans |
tpi-1(gk5612[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ II. Show Description
[NOTE: Please see RG5015 for balanced version of this strain.] Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 3448 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: CTCCTGGGCTTGTTCTCCAGAAGCAGTCTT. Right flanking sequence: TTTGGCGAAAACTCGATTTTTTACCAAAAC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VC4542 |
C. elegans |
bir-2(gk5613[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) V. Show Description
Homozygous viable. Deletion of 2440 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: ATTTTTGTTCGAGAGGACTTCACGAAGTGC. Right flanking sequence: GGTGGATTAAAATTTTTAATCACTTGCCAC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VC4543 |
C. elegans |
swah-1(gk5614[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) I. Show Description
Homozygous viable. Deletion of 10041 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TAATAATGGACAAAATGGGGGATCAAACCA. Right flanking sequence: GGAGGCAACATAGAAGGCGACAACGAGAAT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VC4544 |
C. elegans |
F53B6.7(gk5615[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) I. Show Description
Homozygous viable. Deletion of 2487 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TCGAATGTGTTAATAAAAAATGTTCCAATT. Right flanking sequence: GACAGGAGGGGGAAAGATCAATAATATACA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VC4545 |
C. elegans |
nasp-2(gk5616[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) V. Show Description
Homozygous viable. Deletion of 2208 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: CATAGATTTAAAGTGAATGGTTGGCTGGTG. Right flanking sequence: GCGGGACGCGGAGCCAGGGAAAGTGGCAGC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VC4546 |
C. elegans |
C56G2.15(gk5617[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) III. Show Description
Homozygous viable. Deletion of 1123 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TACTGGTGATCAATCGTGTTGACGTCCACA. Right flanking sequence: GATGGCCTAGAAATCTCAACTCTAGATTTC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VC4547 |
C. elegans |
C47E8.11(gk5618[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) V. Show Description
Homozygous viable. Deletion of 467 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: AAGAAGCACATTTGAACAGTTTAGATACTC. Right flanking sequence: GCCCTTGAGAAATTGAAAGCAGCTTTACTG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VC4548 |
C. elegans |
C52E4.7(gk5619[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) V. Show Description
Homozygous viable. Deletion of 1504 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TCTGAAACATATTAAAATATTGCAACGCCC. Right flanking sequence: TCCACTGACATTTACTGGATTTTCGAATGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VC4549 |
C. elegans |
glb-12(gk5620[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) II. Show Description
Homozygous viable. Deletion of 2310 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TAGTTGACTTTTTTTGAATCCTCTTACCGA. Right flanking sequence: CTTGGAAATCAAATAAATCCTAACTGAAAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VC4550 |
C. elegans |
C54E4.4(gk5621[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) IV. Show Description
Homozygous viable. Deletion of 4697 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: CACCCGTAGAAATACACACAAAACGAGGCT. Right flanking sequence: GCAAACTACAATCGGATTAAAACGGTGCAC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VC4551 |
C. elegans |
C49C8.6(gk5622[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) IV. Show Description
Homozygous viable. Deletion of 1267 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: CCGGAAAAACCCTTCTAGCACTGCAGTTCT. Right flanking sequence: CTTGGAATTTGTTTGAAAAACCTGAAATAT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VC4552 |
C. elegans |
sssh-1(gk5623[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) X. Show Description
Homozygous viable. Deletion of 2574 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TTCAATTATTTTCTTCTTGTTCTTCCACCT. Right flanking sequence: TGGTAATTTATGCAACAATGACGTCAATTT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VC4553 |
C. elegans |
tomm-20(gk5624[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ V. Show Description
Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 1063 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: ATAAGAGCAACAGACAATGAGGATCCGTGA. Right flanking sequence: ATTGTGTCCGACATTCCTGTAAAATACAAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VC4554 |
C. elegans |
F02E9.5(gk5625[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) I. Show Description
Homozygous viable. Deletion of 1319 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: ATAAAACAGTATCTGTAGTAGGTCAAAAGA. Right flanking sequence: CGTGGCGAGACCCACTCACAAAAACAACAT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VC4555 |
C. elegans |
fdps-1(gk5626[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ I. Show Description
Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 6342 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: ATTTTTGCAAAGGGTTTCTGTGGGTGAAAG. Right flanking sequence: TATTTTCGTAAATTCGAGAGAAATGATGCA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VC4556 |
C. elegans |
mrpl-44(gk5627[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ III. Show Description
Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 2142 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. [NOTE: GFP+ animals also have GFP expression in body wall.] Left flanking sequence: GATGGGAGGACAAAGAGCAAAGCGGAGATG. Right flanking sequence: ATATTTCCGGTGCTCCAATTCTGTGTCCAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VC4557 |
C. elegans |
F55A11.11(gk5628[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) V. Show Description
Homozygous viable. Deletion of 1154 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TAAATCATTTTTTCAATCATCGAGCCGGTT. Right flanking sequence: TTGTCAATGGGATCCTATTCCAACAAAATT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VC4558 |
C. elegans |
F27C1.4(gk5629[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) I. Show Description
Homozygous viable. Deletion of 502 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TTTCATTCTTTTTTCCTTCCGTTGCCGGTC. Right flanking sequence: TTCGGGTCTATTTTAATATTACTGTCCAAT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VC4559 |
C. elegans |
mib-1(gk5630[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) III. Show Description
Homozygous viable. Deletion of 3828 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TCTGCAGATGTGACATTGCTTCTTCAGTTT. Right flanking sequence: TGACCGAGAAGCTGAAAATGTTGAAGATTT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VC4560 |
C. elegans |
acdh-12(gk5631[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) II. Show Description
Homozygous viable. Deletion of 2565 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TGTTGAAGAGTGAGTCCTCCATTTCCACAG. Right flanking sequence: GGAGGACGGTCATTGTTATCTCTTGTAGAC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VC4561 |
C. elegans |
cox-7C(gk5632[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ I. Show Description
[NOTE: Please see RG5024 for balanced version of this strain.] Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 1095 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: ACATCAAAGTCAGAGTTTTATGGCTCACCG. Right flanking sequence: GGGGCTTGTAAGATGAGAAGCACCCGTTCT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VC4565 |
C. elegans |
psmd-9(gk5633[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) II. Show Description
Homozygous viable. Deletion of 854 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: AAAACGACATATTTTTAAATGCAATCTTTG. Right flanking sequence: TCCGGTGCTAATGTCTAATGTGATTTTTGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VC4566 |
C. elegans |
timp-1(gk5634[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) V. Show Description
Homozygous viable. Deletion of 690 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: AACAGGTCGCCAGTTGAACCTTTCCCGGCG. Right flanking sequence: CTTGGAAGAAGTTTGTGGATTCGGTTGGAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VC4567 |
C. elegans |
F02E9.10(gk5635[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) I. Show Description
Homozygous viable. Deletion of 2929 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TAGTTTCAAGCGACGGGTCCACCACCGGTT. Right flanking sequence: TGCGGTATTCCTTCTTCGTTCATCATATCA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VC4568 |
C. elegans |
F08B4.7(gk5639[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ IV. Show Description
Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 1233 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: ATTCAAAATATTCAGATAATCACACCATGC. Right flanking sequence: GTGTGTCAACAGGGCACGAGAAATACGCAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|