WM180 |
C. elegans |
nmy-2(ne1490) I. Show Description
Isolated from Hawaiian strain CB4856. Temperature sensitive embryonic lethal. Cytokinesis failure and polarity defects at 25C. Maintain at 15C. RNAi sensitive.
|
|
WM286 |
C. elegans |
mut-2(ne3370) I. Show Description
RNAi deficient. Temperature-sensitive sterile. In-frame deletion. Reference: Chen CC, et al. Curr Biol. 2005 Feb 22;15(4):378-83.
|
|
WM53 |
C. elegans |
alg-2(ok304) II. Show Description
T07D3.7. Homozygous viable, contains an out of frame deletion removing nucleotides encoding amino acids 34-374. This strain cannot be distributed to for-profit companies. Do not distribute this strain; other labs should request it from the CGC. URL: http://www.celeganskoconsortium.omrf.org.
|
|
WM73 |
C. elegans |
mbk-2(ne992) IV. Show Description
Defective in mitotic spindle orientation. Mis-segregation of germline proteins PGL-1 and PIE-1. Change of cell fate (extra-gut, no gut). Defective in chromosome segregation. Temperature sensitive; maintain at 15C; 100% lethal at 25C.
|
|
WM74 |
C. elegans |
wrm-1(ne1982) III. Show Description
Temperature sensitive embryonic lethal. Maintain at 15C. Received new stock 3/20/2008 from Mello lab.
|
|
WM92 |
C. elegans |
mom-4(ne1539) I. Show Description
Temperature sensitive embryonic lethal. Maintain at 15C. Received new stock 3/20/2008 from Mello lab. Replacement stock received from Mello Lab 01/14/2010.
|
|
WM93 |
C. elegans |
lit-1(ne1991) III. Show Description
Temperature sensitive embryonic lethal. Maintain at 15C.
|
|
WRM45 |
C. elegans |
mex-3(spr5[*tn1753]) I. Show Description
Homozygous fertile; reduced brood size. mex-3(spr5) is a CRISPR/Cas9 engineered deletion removing 488 bp of the mex-3 3´UTR. Reference: Albarqi MMY & Ryder SP. PLoS Genet 2021 Aug 23;17(8):e1009775. PMID: 34424904
|
|
WRM49 |
C. elegans |
mex-3(spr6[*tn1753]) I. Show Description
Homozygous fertile. mex-3(spr6) is a CRISPR/Cas9 engineered deletion removing 142 bp of the mex-3 3´UTR. Reference: Albarqi MMY & Ryder SP. PLoS Genet 2021 Aug 23;17(8):e1009775. PMID: 34424904
|
|
WRM50 |
C. elegans |
mex-3(spr7[*tn1753]) I. Show Description
Homozygous fertile. mex-3(spr7) is a CRISPR/Cas9 engineered deletion removing 134 bp of the mex-3 3´UTR. Reference: Albarqi MMY & Ryder SP. PLoS Genet 2021 Aug 23;17(8):e1009775. PMID: 34424904
|
|
WRM52 |
C. elegans |
mex-3(spr9[*tn1753]) I. Show Description
Homozygous fertile; reduced brood size. mex-3(spr9) is a CRISPR/Cas9 engineered deletion of the mex-3 3´UTR (removes 624 of 689 bp). Reference: Albarqi MMY & Ryder SP. PLoS Genet 2021 Aug 23;17(8):e1009775. PMID: 34424904
|
|
WRM53 |
C. elegans |
mex-3(spr10[*tn1753]) I. Show Description
Homozygous fertile; reduced brood size. mex-3(spr5) is a CRISPR/Cas9 engineered deletion removing 190 bp of the mex-3 3´UTR. Reference: Albarqi MMY & Ryder SP. PLoS Genet 2021 Aug 23;17(8):e1009775. PMID: 34424904
|
|
WS1433 |
C. elegans |
hus-1(op241) I; unc-119(ed3) III; opIs34. Show Description
opIs34 [hus-1p::hus-1::GFP + unc-119(+)]. Low-copy integrated array of 1144 bp hus-1 promoter and genomic coding sequence fused to GFP. Nuclear expression of GFP in germ cells and embryos. Integrated GFP construct completely rescues DNA damage induced cell cycle arrest defect and partially rescues DNA damage induced apoptosis of hus-1(op241).
|
|
WU125 |
C. elegans |
lin-1(n1790) IV. Show Description
n1790 causes a partially penetrant "rod-like" larval lethal phenotype (17% at 20C) and a partially penetrant vulvaless defect (50% at 20C). A Smg mutation enhances these phenotypes. The n1790 mutation is a nonsense change at codon 352.
|
|
WU1854 |
C. elegans |
pcn-1(am315[3xFLAG]) IV/nT1 [qIs51] (IV;V). Show Description
Homozygous maternal effect lethal mutation balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP am315 homozygotes (maternal effect lethal). Homozygous nT1[qIs51] inviable. Pick wild-type GFP and check for correct segregation of progeny to maintain. 3xFLAG epitope allows antibody detection of full-length PCN-1. Reference: Kocsisova Z, et al. BMC Dev Biol. 2018 May 30;18(1):12.
|
|
WU321 |
C. elegans |
cgr-1(n2528) X. Show Description
Slow growing at 20C. About 50% larval lethality at 15C. Maintain at 20C.
|
|
WU48 |
C. elegans |
lin-45(n2018) dpy-20(e1282) IV. Show Description
Intermediate severity of lin-45 raf allele: at 20C, 76% larval lethal and 24% display an abnormal vulva (either Egl, no discernable vulva, or PVul). Medium Dpy. Received new stock 11/2002.
|
|
WU49 |
C. elegans |
lin-45(n2506) unc-24(e138) IV. Show Description
Intermediate strength lin-45 raf allele: 86% larval lethal, 93% of adults display an abnormal vulva (either Egl, no discernable vulva, or PVul), and 3% of adults are Sterile. Unc.
|
|
WU57 |
C. elegans |
lin-45(n2510) unc-24(e138)/unc-5(e53) dpy-20(e1282) IV. Show Description
Heterozygotes are non-Unc and segregate non-Unc, Sterile Unc, and Dpy Unc. n2510 is a strong lin-45 raf allele: 100% of homozygotes are Sterile and Vul (no discernable vulva) or larval lethal.
|
|
WU680 |
C. elegans |
cgr-1(am114) X. Show Description
Slow growing at 20C. 100% larval lethality at 15C. Maintain at 20C.
|
|
WY114 |
C. elegans |
pha-1(fd1) III. Show Description
Wt. Synthetic lethal with lin-35/Rb. High % Pun in lin-35 background.
|
|
WY184 |
C. elegans |
xnp-1(fd2) I. Show Description
WT. Synthetic lethal with lin-35/Rb. Lower brood size than WT. High % gonad morphogenesis in lin-35 background.
|
|
XA4900 |
C. elegans |
rib-2(qa4900)/qC1 [dpy-19(e1259) glp-1(q339) III. Show Description
Heterozygotes are WT and segregate WT and Sterile Dpys. Homozygous rib-2(qa4900) animals give homozygous F2 animals that can develop to the adult stage but exhibit abnormal phenotypes such as egg-laying defects, increased body width, and reduced activity in movement. While the F2 qa4900 homozygotes are fertile, the F3 qa4900 homozygous progeny stop developing during gastrulation and fail to develop normally. 511 bp deletion in the region of intron2 to exon 6 of the rib-2 gene (K01G5.6).
|
|
XA6226 |
C. elegans |
mrg-1(qa6200)/qC1 [dpy-19(e1259) glp-1(q339) qIs26] III. Show Description
qIs26 [lag-2::GFP + rol-6(su1006)]. Heterozygotes are Rollers and GFP+ in the distal tip cell. qIs26 was integrated into qC1 and in the process made qC1 homozygous lethal. qIs26 contains lag-2::GFP. qa6200 has maternal effect sterility and maternal effect embryonic lethality.
|
|
XA6227 |
C. elegans |
mrg-1(tm1227)/qC1 [dpy-19(e1259) glp-1(q339) qIs26] III. Show Description
qIs26 [lag-2::GFP + rol-6(su1006)]. Heterozygotes are Rollers and GFP+ in the distal tip cell. qIs26 was integrated into qC1 and in the process made qC1 homozygous lethal. qIs26 contains lag-2::GFP. tm1227 has maternal effect sterility and maternal effect embryonic lethality.
|
|
XA7400 |
C. elegans |
glc-3(ok321) V. Show Description
ZC317.3 Homozygous. Outer Left Sequence: TCAAAATACAGGGGTAGGCG. Outer Right Sequence: ACAATTCCTGGAACTCACGG. Inner Left Sequence: TGAAGAGGTTTTGAAACGCA. Inner Right Sequence: ACTTTCCGAGAGGAATGGGT. Inner Length: 2746. Estimated Deletion Size: 1200. This strain was provided by the C. elegans Gene Knockout Project at OMRF, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. http://www.mutantfactory.ouhsc.edu/
|
|
XA7401 |
C. elegans |
R09B5.11(ok1759) V. Show Description
R09B5.11 Homozygous. Outer Left Sequence: ctgtcgcaagtcctgattga. Outer Right Sequence: gtttccggaacaaacttcca. Inner Left Sequence: gaacgagtgtttctgggacg. Inner Right Sequence: atgaggaaggcgtactggtg. Inner Primer PCR Length: 3113. Deletion size: 1273 bp. Left flank: TATCAGTTTGAAGAGGCACTCGAAAACCTT. Right flank: ACTGTTCTATATATAAGCTGAAGTTCAACC. This strain was provided by the C. elegans Gene Knockout Project at OMRF, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. http://www.mutantfactory.ouhsc.edu/
|
|
XA780 |
C. elegans |
gna-2(qa705)/goa-1(n499) I. Show Description
Heterozygotes are Egl and Paralyzed. Segregate embryonic lethals (n499) homozygotes. Segregates WT animals that lay only non-refractile eggs that fail to hatch. Pick paralyzed Egl worms to maintain (eggs on the plate should all be pale brown and non-refractile; presence of refractile eggs indicates a recombination has occurred). XA780 recombines at a frequency of about 1%.
|
|
XA8106 |
C. elegans |
hcf-1(pk924) IV. Show Description
Pleiotropic defects including reduced broodsize, reduced levels of histone H3 serine 10 phosphorylation, cold-sensitive embryonic lethality, cold-sensitive early embryonic mitotic and cytokinetic defects. Reference: Lee S, et al. PLoS One. 2007 Nov 28;2(11):e1213.
|
|
XE2260 |
C. elegans |
casy-1(wp78) II. Show Description
wp78 is a CRISPR/Cas9-engineered 11.5 kb deletion removing the entire coding region of casy-1, the C. elegans homolog of calsyntenin. casy-1(wp78) phenocopies the casy-1(wp60) point mutation and strongly suppresses PVQ degeneration in both ric-7(n2657) and miro-1(wy50180); mtx-2(wy50266) mutants. Reference: Ding C, et al. Elife. 2022 Mar 14;11:e73557. PMID: 35285800.
|
|
XR1 |
C. elegans |
abl-1(ok171) X. Show Description
1.5 kb of M79.1 locus is deleted which corresponds to the elimination of exons 8-12, including the kinase domain and 2/3 of the SH2 domains.
|
|
XY1054 |
C. elegans |
cep-1(lg12501) I. Show Description
1213 bp deletion corresponding to bp 30458-31670 on cosmid F52B5. Takes out a large part of the cep-1 open reading frame.
|
|
XZ2056 |
C. elegans |
hif-1(ia4) V; yakEx126. Show Description
yakEx126 [unc-17p::hif-1(cDNA) + myo-2p::mCherry]. Pick animals with red pharynx to maintain. HIF-1 expressed from cholinergic neuron-specific promoter in hif-1 mutant background for tissue-specific rescuing experiments. yakEx126 does not rescue lethality in hif-1 mutant animals exposed to 50ppm hydrogen sulfide. Reference: Topalidou I & and Miller DL. bioRxiv 174581; doi: https://doi.org/10.1101/174581.
|
|
XZ2065 |
C. elegans |
hif-1(ia4) V; yakEx131. Show Description
yakEx131 [eft-3p::hif-1(cDNA) + myo-2p::mCherry]. Pick animals with red pharynx to maintain. HIF-1 expressed from a ubiquitous promoter in hif-1 mutant background for tissue-specific rescuing experiments. yakEx131 rescues lethality in hif-1 mutant animals exposed to 50ppm hydrogen sulfide. Reference: Topalidou I & and Miller DL. bioRxiv 174581; doi: https://doi.org/10.1101/174581.
|
|
XZ2073 |
C. elegans |
hif-1(ia4) V; yakEx137. Show Description
yakEx137 [unc-14p::hif-1(P621A)::YFP + myo-2p::mCherry]. Pick animals with red pharynx to maintain. Non-degradable form of HIF-1 tagged with YFP expressed from unc-14 promoter in hif-1 mutant background for tissue-specific rescuing experiments. yakEx137 rescues lethality in hif-1 mutant animals exposed to 50ppm hydrogen sulfide. Reference: Topalidou I & and Miller DL. bioRxiv 174581; doi: https://doi.org/10.1101/174581.
|
|
XZ2074 |
C. elegans |
hif-1(ia4) V; yakEx136. Show Description
yakEx136 [vha-6p::hif-1(cDNA) + myo-2p::mCherry]. Pick animals with red pharynx to maintain. HIF-1 expressed from intestine-specific promoter in hif-1 mutant background for tissue-specific rescuing experiments. yakEx136 does not rescue lethality in hif-1 mutant animals exposed to 50ppm hydrogen sulfide. Reference: Topalidou I & and Miller DL. bioRxiv 174581; doi: https://doi.org/10.1101/174581.
|
|
XZ2081 |
C. elegans |
hif-1(ia4) V; yakEx143. Show Description
yakEx143 [dpy-7p::hif-1(cDNA) + myo-2p::mCherry]. Pick animals with red pharynx to maintain. HIF-1 expressed from a hypodermal-specific promoter in hif-1 mutant background for tissue-specific rescuing experiments. yakEx143 does not rescue lethality in hif-1 mutant animals exposed to 50ppm hydrogen sulfide. Reference: Topalidou I & and Miller DL. bioRxiv 174581; doi: https://doi.org/10.1101/174581.
|
|
XZ2082 |
C. elegans |
hif-1(ia4) V; yakEx144. Show Description
yakEx144 [unc-14p::hif-1(cDNA) + myo-2p::mCherry]. Pick animals with red pharynx to maintain. HIF-1 expressed from unc-14 promoter in hif-1 mutant background for tissue-specific rescuing experiments. yakEx144 rescues lethality in hif-1 mutant animals exposed to 50ppm hydrogen sulfide. Reference: Topalidou I & and Miller DL. bioRxiv 174581; doi: https://doi.org/10.1101/174581.
|
|
XZ2083 |
C. elegans |
hif-1(ia4) V; yakEx145. Show Description
yakEx145 [unc-47p::hif-1(cDNA) + myo-2p::mCherry]. Pick animals with red pharynx to maintain. HIF-1 expressed from GABA-ergic neuron-specific promoter in hif-1 mutant background for tissue-specific rescuing experiments. yakEx145 does not rescue lethality in hif-1 mutant animals exposed to 50ppm hydrogen sulfide. Reference: Topalidou I & and Miller DL. bioRxiv 174581; doi: https://doi.org/10.1101/174581.
|
|
XZ2084 |
C. elegans |
hif-1(ia4) V; yakEx125. Show Description
yakEx125 [rab-3p::hif-1(cDNA) + myo-2p::mCherry]. Pick animals with red pharynx to maintain. HIF-1 expressed from pan-neuronal-specific promoter in hif-1 mutant background for tissue-specific rescuing experiments. yakEx125 does not rescue lethality in hif-1 mutant animals exposed to 50ppm hydrogen sulfide. Reference: Topalidou I & and Miller DL. bioRxiv 174581; doi: https://doi.org/10.1101/174581.
|
|
XZ2085 |
C. elegans |
hif-1(ia4) V; yakEx146. Show Description
yakEx146 [vha-6p::hif-1(cDNA) + dpy-7p::hif-1(cDNA) + rab-3p::hif-1(cDNA) + myo-2p::mCherry]. Pick animals with red pharynx to maintain. HIF-1 expressed from pan-neuronal-, hypodermal-, and intestinal-specific promoters in hif-1 mutant background for tissue-specific rescuing experiments. yakEx146 does not rescue lethality in hif-1 mutant animals exposed to 50ppm hydrogen sulfide. Reference: Topalidou I & and Miller DL. bioRxiv 174581; doi: https://doi.org/10.1101/174581.
|
|
YK31 |
C. elegans |
tbx-9(ms31) III. Show Description
Deletion of 3.0 kb of the genomic region that extends from 2.1 kb upstream to the middle of the tbx-9 gene. Incompletely penetrant morphogenic defects in embryogenesis. Failure in proper formation of hypodermis and body-wall muscle.
|
|
YL139 |
C. elegans |
meg-1(vr10) X. Show Description
Maternal effect sterility at 25 degrees. Can be maintained at 20C. Deletion breakpoints: AGATGCCACATACAAACGCT / CTGGCGGAAGACGATGCAAA Reference: Leacock SW & Reinke V. Genetics. 2008 Jan;178(1):295-306.
|
|
YL140 |
C.elegans |
meg-1(vr11) X. Show Description
Maternal effect sterility at 25 degrees. Can be maintained at 20C. Deletion breakpoints: CAGTTCCAAATGAATCAAAG / CTGGCGGAAGACGATGCAAA Reference: Leacock SW & Reinke V. Genetics. 2008 Jan;178(1):295-306.
|
|
YL585 |
C. elegans |
oef-1(vr25) IV. Show Description
vr25 is a Crispr/Cas9-induced 56 bp deletion in exon 2 of oef-1/F49E8.2 causing a frameshift and presumptive null allele. Accelerated rate of germ cell progression, precocious Z2/Z3 division in L1s, increased brood size and sperm generation, and increased germline apoptosis. Reference: McManus, CE & Reinke, V. Genetics. 2017; https://doi.org/10.1534/genetics.117.1123.
|
|
YS2 |
C. elegans |
cbp-1(bm1) dpy-18(e364)/qC1 [dpy-19(e1259) glp-1(q339)] III. Show Description
Heterozygotes are WT and segregate WT, Dpy Steriles and dead eggs. cbp-1 is embyronic lethal. ys2 is an internal deletion in cbp-1. NOTE: THIS STRAIN WAS FORMERLY IDENTIFIED AS HA1000 cbp-1(ys2) dpy-18(e364)/qC1 dpy-19(e1259) glp-1(q339) III. The strain name and allele were corrected per Anne Hart, 2010.
|
|
YS4 |
C. elegans |
cbp-1(bm2) dpy-18(e364)/qC1 [dpy-19(e1259) glp-1(q339)] III. Show Description
Heterozygotes are WT and segregate WT, Dpy Steriles and dead eggs. cbp-1 is embyronic lethal. ys4 is an N-terminal deletion in cbp-1. NOTE: THIS STRAIN WAS FORMERLY IDENTIFIED AS HA990 cbp-1(ys4) dpy-18(e364)/qC1 dpy-19(e1259) glp-1(q339) III. The strain name and allele were corrected per Anne Hart, 2010.
|
|
ZE1 |
C. elegans |
F53B2.5(ok226) Show Description
Homozygotes are viable and do not show any gross abnormalities. Grows normally at all temperatures. Deletion removes 1505 bp including the first 4 exons.
|
|
ZG31 |
C. elegans |
hif-1(ia4) V. Show Description
Healthy and fertile in standard lab conditions, but unable to adapt to 1% oxygen. When hif-1(+) animals are incubated in1% oxygen, >94% will complete embryogenesis and larval development. In contrast, hif-1(ia4) mutants exhibit 66% embryonic lethality and 9% larval lethality in 1% oxygen. The requirement of hif-1 is alleviated if the oxygen level is increased to 2%. The ia4 mutation is a 1231 bp deletion of the second, third, and fourth exons, which encode much of the helix-loop-helix and PAS domains. Analysis of ESTs suggests that there are at least 4 alternatively spliced hif-1 transcripts. The ia4 deletion introduces a frameshift and a premature stop in the three longest forms.
|
|
ZH1963 |
C. elegans |
enIs59 I; unc-76(e911) V. Show Description
enIs59 [ced-1p::2xFYVE::GFP + unc-76(+)] I. ced-1p::2xFYVE::GFP is a phosphainositol PtdIns(3)P reporter expressed in engulfing cells for assaying cell corpse clearance and other membrane trafficking events. GFP expression from enIs59 is relatively low and causes the least deleterious effects to worm development. Reference: Lu N, et al. PLoS Biol. 2012 Jan;10(1):e1001245. PMID: 22272187
|
|