Distal tip cell migration defective.

D2089.4. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y105E8A.10 Homozygous. Outer Left Sequence: gcgtgacgacggtcttttat. Outer Right Sequence: tttcgagttcaaaattcggg. Inner Left Sequence: tagtcgttgttgttggcagc. Inner Right Sequence: acaacacatttaacgcgcaa. Inner Primer PCR Length: 2600. Estimated Deletion Size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

H35N03.1 Homozygous. Outer Left Sequence: AGATCCAATGAAATCGGTGC. Outer Right Sequence: ACATCGTTTTTATGGCCACC. Inner Left Sequence: TTGCCTTGCAAGACTCAAAA. Inner Right Sequence: CACAGCATCGACCAGAAATG. Inner Primer PCR Length: 2329. Estimated Deletion Size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F26E4.8 Homozygous. Outer Left Sequence: gggcacttgaagttgatggt. Outer Right Sequence: cctttcctcgcaccagaata. Inner Left Sequence: tcgggaagttaagcgtcatt. Inner Right Sequence: cagcccgactttcatttctc. Inner Primer PCR Length: 2176. Estimated Deletion Size: about 900 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

wyIs813 [unc-86p::GFP::tba-1 + unc-86p:mCherry::PLCdP]. tba-1(ok1135) is a 1036 bp deletion. Strong expression of GFP::TBA-1 signal, low mCherry::PLCdP signal. Reference: Liang X, et al. Elife. 2020 Jul 13:9:e56547. PMID: 32657271.

C34D1.1. Identified by PCR, validated by CGH. External left primer: AGGCTGACGGCTTCTAATGA. External right primer: GCGGTAGTGCATTCCAATTT. Internal left primer: GATGGCTGGAATGTTGGAGT. Internal right primer: GAGACATGCACACTAGCCGA. Internal WT amplicon: 1370 bp. Deletion size: 265 bp. Deletion left flank: TACGCACCTTTTGTGTCCCTTCAGGCGTGA. Deletion right flank: AGAAAAATAAAGTAAAAGAAACTGGAAAAT. Insertion Sequence: ATG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C34D1.1. External left primer: AGGCTGACGGCTTCTAATGA. External right primer: GCGGTAGTGCATTCCAATTT. Internal left primer: GATGGCTGGAATGTTGGAGT. Internal right primer: GAGACATGCACACTAGCCGA. Internal WT amplicon: 1370 bp. Deletion size: 571 bp. Deletion left flank: AAAAAGGAAAACGGTGTTTTCTACTACCAC. Deletion right flank: GTGAGTGCTGGAGGAGGTTGTTTTTCGAAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C34D1.1, B0462.4. The allele gk1133 was identified by PCR, validated by CGH, and can be detected with the following PCR primers. External left primer: AGGCTGACGGCTTCTAATGA. External right primer: GCGGTAGTGCATTCCAATTT. Internal left primer: GATGGCTGGAATGTTGGAGT. Internal right primer: GAGACATGCACACTAGCCGA. Internal WT amplicon: 1370 bp. Deletion size: 337 bp. Deletion left flank: TTTTTTTCAGATATTTAGGTTAGTCCACTT. Deletion right flank: GGGCACGCCCACTTTATACTATTTTGATGT. Insertion Sequence: TAT. The allele gk3031 was identified by CGH and not confirmed by PCR. Left flanking probe: TTATAAACAGAGACAAATTTAGACCAAAACTCTGTAGGAAAGTGAGTTTT. Right flanking probe: ACAGGAATATGAATTGAGTGATTGCTTGTGGTAGACTCTGTAGATGGTCT. Left deleted probe: AAGTGAGTTTTTCCGTGTGTTCTGTGGGATCAGGTGCTCCAAATCTTCCA. Right deleted probe: GCGCCAATGCTAATATTATACTTATATAAAAGCACTTAACAAGCTGAGCT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

This strain is homozygous for a deletion (gk1130) in B0336.11, detectable by PCR using the following primers. External left primer: TGTTTCCTGAAGTGGCACAG. External right primer: AGCACTCACTGAAGGGGAGA. Internal left primer: ATTCTGCCTTGTTGCTTGCT. Internal right primer: CCGTTGCTCTCTGTGCTCTA. Internal WT amplicon: 2566 bp. Deletion size: 416 bp. Deletion left flank: TAATAAACTTCATTGCGTCAAAGCTCTGAA. Deletion right flank: CATAATTGCATATGCAATATCTACATCGTA. Validation: gk1130 passed by CGH. Other deletion (gk3213) identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

R07B7.16. External left primer: ATGGTGCATTGATGGTCAGA. External right primer: GCGGAAAACTCCAAACGATA. Internal left primer: CTTCCTGAATCAGCACAGCA. Internal right primer: GGCCCGTCTTGTTAACTTCA. Internal WT amplicon: 2735 bp. Deletion size: 1749 bp. Deletion left flank: TACTGTGAATATTGAACTGATCCATGAAAT. Deletion right flank: ATAGAGTTTCAGCTGTCCCTGGTCTCACAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T12D8.8. Identified by PCR, validated by CGH. External left primer: CGAATCGATCCGATCTTCAT. External right primer: GGGATCGATAATGGCTCAGA. Internal left primer: GTTTCCGGAGTTGGAACTGA. Internal right primer: TTGCGAACAACAAATCCTCA. Internal WT amplicon: 1279 bp. Deletion size: 764 bp. Deletion left flank: AAGAAATCAACACAATTTAATGTTAAAGAT. Deletion right flank: GAACCCGCTCTCTACGCTCCGCGAGCTCGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y106G6H.14. Identified by PCR, validated by CGH. External left primer: GGATGCTAGTTTGGAGAGCG. External right primer: AACAGCTGACAAGGAGCGAT. Internal left primer: GTGAACCATCCGATTATGCC. Internal right primer: AATTCGAGAAGAACGATGCG. Internal WT amplicon: 1747 bp. Deletion size: 767 bp. Deletion left flank: CGTTATTCAGCCGCAAAATTAGAGAAATCT. Deletion right flank: AGACATTCAGCCAGCATATCCATATTTCCA. Insertion Sequence: CGACTTTCGCGACG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T19D12.5. External left primer: TCCACTCAAGATGACACCCA. External right primer: CACATTAGGCCAAAATGCCT. Internal left primer: CGGCAAACTTCTGGAACAAT. Internal right primer: ACAATCCCAGCATCCGTATC. Internal WT amplicon: 1654 bp. Deletion size: 685 bp. Deletion left flank: ACAACTTCTTCTGATTTTTCAAGATGTTTC. Deletion right flank: TCCACCTTTTCCAATCAATCCCTCAATCAA. Insertion Sequence: AAGATT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

ZK430.2. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT relatively dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok1132 homozygotes (early larval arrest). Pick WT dim GFP and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

B0334.11a. Homozygous subviable deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok1134 homozygotes (variable phenotypes, including Gro, Dpy, Unc, Clr, some embryonic lethality, various other body morphology defects; population cannot be maintained at 20 degrees - other temperatures not tested). Pick WT dim GFP and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y54G11A.5a. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F49E11.4. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F32A7.3a. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

W06B11.2. Gro, Unc, lethargic, often explodes at vulva. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807