More Fields
Strain Species Genotype
VC1061 C. elegans B0303.2(gk457) III. Show Description
B0303.2. Superficially wild type. External left primer: CGCGGTAAATCAGAAAGCTC. External right primer: ATATTTTCAGCACGATCCCG. Internal left primer: TTCAACCATGTCATTTGCGT. Internal right primer: GCACCCAAATCCAGAACACT. Internal WT amplicon: 1716 bp. Deletion size: 631 bp. Deletion left flank: CGGGAGCCTCACACGAACAGAAAGGAGAAG. Deletion right flank: ACAGCAATGCAAATAGTACTCTTCTTTCTA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1079 C. elegans C50F4.16(gk450) V. Show Description
C50F4.16. Superficially wild type. External left primer: TCTCCAGATTGACCGATTCC. External right primer: AATTCGATTCCGGCTTTCTT. Internal left primer: ATCCGGAACACGGTTAACAA. Internal right primer: CGAGACGATGCATGAGAGAA. Internal WT amplicon: 1720 bp. Deletion size: 405 bp. Deletion left flank: CTTCCAGATTGATGAGCACCCACAACAAAT. Deletion right flank: TGATATTTTGATACAAAATCAGTCACAAAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1094 C. elegans rtcb-1(gk451) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
F16A11.2. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP gk451 homozygotes (sterile with vulval blip). Homozygous hT2[bli-4 let-? qIs48] inviable. May also segregate Bli non-GFP (hT2 homozygotes), which are the result of rare recombination. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TGCCCTTCTTCATCAATTCC. External right primer: ATAATTTCTCGGACCCGCTT. Internal left primer: GCGTAATGATTTCCTGCTCC. Internal right primer: CATCATCTTTCCACCACACG. Internal WT amplicon: 1913 bp. Deletion size: 370 bp. Deletion left flank: ATGATTCACTAACCGAATGTCCAACAATTC. Deletion right flank: ATCTCAAAATCTTTAGTCAAGAAAACATTC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1100 C. elegans Y67D8C.5(ok1575) IV. Show Description
Y67D8C.5. Superficially wild type. External left primer: TTCTCCTGTGACAGCATTCG. External right primer: ATCTCAACAAAAGCCCGATG. Internal left primer: AACGACAGTGTGCGAACTTG. Internal right primer: TGTGCTGGGAGTATGAGCTG. Internal WT amplicon: 3242 bp. Deletion size: 1637 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1109 C. elegans spp-10&hlh-12(ok1532) IV. Show Description
C28C12.7, C28C12.8. Often sickly, otherwise superficially wild type. External left primer: TGTCAAGAATGTCATCCCCA. External right primer: TTAAAATGGCGAAGAAACCG. Internal left primer: CCATCTAGCCCCATCTCAAA. Internal right primer: CCGAGATGAACGGAATGTTT. Internal WT amplicon: 2182 bp. Deletion size: 1866 bp. Deletion left flank: ATCTAGCCCCATCTCAAATGCTCACAATCT. Deletion right flank: ACAGTTATTGCGTCTATGTCACTATTTGAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1117 C. elegans +/mT1 II; paa-1(ok1539)/mT1 [dpy-10(e128)] III. Show Description
F48E8.5. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and ok1539 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: TCTCTGCGTATCACTGTCGC. External right primer: CAGAGTTTTGTCTCGAGGGC. Internal left primer: CTCTTGTTCTCCTCATGCCC. Internal right primer: CTCGGGAACAAAAATGGAAA. Internal WT amplicon: 2209 bp. Deletion size: 621 bp. Deletion left flank: TTGGCGTTGGGTGTGGAGCGCACACGCAAC. Deletion right flank: AAGAAGAAACTCATCGAGCCAATTCTCATT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1119 C. elegans dyf-2&ZK520.2(gk505) III. Show Description
ZK520.1. Superficially wild type. External left primer: CTCGCAATTCCAGACTGACA. External right primer: CGGAGTGAAGTATCCGGTGT. Internal left primer: TCTGCGGATTCTCCATAACC. Internal right primer: GCGGCAGTTCCGTTATATGT. Internal WT amplicon: 1950 bp. Deletion size: 403 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1125 C. elegans rig-6(ok1589) II. Show Description
C33F10.5. Superficially wild type. External left primer: GAGCCGTTTTAACCCAATCA. External right primer: TAATTTTCAGAACCGTCGGG. Internal left primer: ACGTTCTGCTGCTCTCCATT. Internal right primer: GCAACCAACTCCTTCCATTC. Internal WT amplicon: 3304 bp. Deletion size: 1554 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1129 C. elegans noah-1(ok1587)/szT1 [lon-2(e678)] I; +/szT1 X. Show Description
C34G6.6. Apparent homozygous lethal deletion chromosome balanced by lon-2-marked translocation. Heterozygotes are WT, and segregate WT, Lon-2 males, arrested szT1 aneuploids, and ok1587 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: AAGCAGATGAATCGAAACGG. External right primer: CTCGAGACAAGCCAATGTCA. Internal left primer: TCTTCACAGCCGATGACTTG. Internal right primer: CAATGAAGGTCTTTGCGGTT. Internal WT amplicon: 3308 bp. Deletion size: 2455 bp. Deletion left flank: TCACAGCCGATGACTTGATTTCAATAGCTC. Deletion right flank: TGAGAGTATACAATTTTGAAATATATTTTC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1134 C. elegans C02B4(gk534) X. Show Description
C02B4. Superficially wild type. External left primer: TGTGTGTGTCGAACGTGAAA. External right primer: TCCGATAAAATCTGCTCGCT. Internal left primer: CAGTTTCCCAGCTTTCTTCG. Internal right primer: TGCTCATTGATGTTTGAGGG. Internal WT amplicon: 1884 bp. Deletion size: 657 bp. Deletion left flank: CTAGAACCTACAATCACAAAATAATGCACC. Deletion right flank: ATATATTTATGTTTCAAAGTGTTATGCAAC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1135 C. elegans R166.3(gk541)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
R166.3. Homozygous marginally-viable deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP gk541 homozygotes (mostly sterile; some animals bear a few progeny, but a population may be difficult to maintain). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: GAGGAGTACACGCCGGATAA. External right primer: AGACCATTTTGCAGGATTGC. Internal left primer: AAGTGCTGACCGAAGAGCAT. Internal right primer: TGGGATTTGAAACGAGAACC. Internal WT amplicon: 1529 bp. Deletion size: 388 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1138 C. elegans drsh-1(ok369) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
F26E4.10. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok369 homozygotes (sterile adult). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TGGTCTCGAAGTTCTTGCCT. External right primer: AAACGAAGAACGAGCTGGAA. Internal left primer: TCAGGAACCATCGTGTGAAA. Internal right primer: CTTGCATGCCATCATATTCG. Internal WT amplicon: 2395 bp. Deletion size: 1742 bp. Deletion left flank: CTAGATTAGCCAAAGCCAGCTCAGCCACCC. Deletion right flank: TATCGTTGAATTTATATTCGATGACTTCTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1139 C. elegans mom-4(gk563) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
F52F12.3. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP gk563 homozygotes (sterile, eggs don't hatch). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CTGTGAACTTGGCTGTTGGA. External right primer: CGCAGATGTATGGTTTGGTG. Internal left primer: TTGAAACATCCATGAAGCCA. Internal right primer: CACTGATGAACAGCAAACGG. Internal WT amplicon: 2042 bp. Deletion size: 632 bp. Deletion left flank: AAGAATATTTGATTGCTGCTGGCCTGAAAA. Deletion right flank: AGACCAACGGGACACAGACAGATTTCCGAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1141 C. elegans trp-4(ok1605) I. Show Description
Y71A12B.4. Superficially wild type. External left primer: AAGACTCCGGTACACGTTGC. External right primer: AGAAGCATCCGCACAAGACT. Internal left primer: AAGTTTGGTGGCTCAATTCG. Internal right primer: CTTTGAGCGGCTAAATGGAG. Internal WT amplicon: 3332 bp. Deletion size: 1027 bp. Deletion left flank: GGCCGAGGTTACTGGACCAGGACCAGGGCC. Deletion right flank: TTTTACCGATTTTTAGGCAGAATTGATTTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1145 C. elegans pps-1(ok1625) IV/nT1 [qIs51] (IV;V). Show Description
T14G10.1. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok1625 homozygotes (probable early larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: ATTCTCAGAAACCCACGCAT. External right primer: TCTCCACGAGGTTTACCACC. Internal left primer: ACGGGATGAAAACAACGAAG. Internal right primer: AAACGCGTGTCAATATGGGT. Internal WT amplicon: 2542 bp. Deletion size: 1092 bp. Deletion left flank: TGAACGTGTATGTCGTCAATTTGGAACAAA. Deletion right flank: AGAATAAGGAAAATATCAAGAAAATATGGC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1149 C. elegans C25B8.4&kqt-1(ok413) X. Show Description
C25B8.1, C25B8.4. Superficially wild type. External left primer: CAAGCAGCTCCAAGTGATGA. External right primer: CCCGCTAGTGCTACTCCATC. Internal left primer: GAAACATCCCTTTCAACCCA. Internal right primer: TTATGGTGTCGTGCACTCGT. Internal WT amplicon: 2570 bp. Deletion size: 547 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1155 C. elegans +/szT1 [lon-2(e678)] I; F19H6.1(gk506)/szT1 X. Show Description
F19H6.1. Apparent homozygous lethal deletion chromosome balanced by lon-2-marked translocation. Heterozygotes are WT, and segregate WT, Lon-2 males, arrested szT1 aneuploids, and gk506 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: AGGAAAAGAATCGGCCTAGC. External right primer: CACGCAAACGAGAACACAGT. Internal left primer: GGGCTAAGGCTCTCGCTAAT. Internal right primer: CAAATGCATCCAGTAGGCAA. Internal WT amplicon: 1675 bp. Deletion size: 340 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1156 C. elegans F30A10.6(ok1602) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
F30A10.6. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok1602 homozygotes (mid-larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GTAATGGCTCCTTGCTCAGG. External right primer: CCGAACCGCAAGTTGTTTAT. Internal left primer: GTCACAGCTAATGGGAGCGT. Internal right primer: AACTCAACAGGATCCCTCCA. Internal WT amplicon: 3044 bp. Deletion size: 745 bp. Deletion left flank: CTTGTAAATCAAAAAGGAAGAGAGAAAAAA. Deletion right flank: CTACGGAAAACACTTTTTTACTACCTTATC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1158 C. elegans T07F8.4(gk530)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
T07F8.4. Homozygous sterile deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP gk530 homozygotes (sterile adult, lays no eggs). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: TCACTTGGCTGATTCGTCTG. External right primer: TGTGCAAATGGATCAGGTGT. Internal left primer: CCTTCAACCGTTGCTTCATT. Internal right primer: ACAGAACGATCGGGAAGTTG. Internal WT amplicon: 1857 bp. Deletion size: 974 bp. Deletion left flank: GGTTCTGCAGCAGCCGAACTTGATTCCCCT. Deletion right flank: TTACTGAGCAAACGCTTTAGTGTTAGAAAC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1161 C. elegans M04F3.1(ok1627) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
M04F3.1. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok1627 homozygotes (sterile, lays eggs that don't hatch). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CGGAAGAATTTGGAGGATGA. External right primer: GGCTACGAGCAGTTCCTGAC. Internal left primer: GCGTATTGTAAGGCACGGTT. Internal right primer: AATGTGATTTGCCGTTCCTC. Internal WT amplicon: 2153 bp. Deletion size: 917 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1162 C. elegans +/mT1 II; spe-41(ok1590)/mT1 [dpy-10(e128)] III. Show Description
K01A11.4. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and ok1590 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: TCACTATCCCCACAGAAGCC. External right primer: ATACCTACGCCCGCCTACTT. Internal left primer: GCGCGTAAACTTCTTTCCAG. Internal right primer: TCTCCACATTTTCCACCACA. Internal WT amplicon: 3007 bp. Deletion size: 1099 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1165 C. elegans let-19&sgn-1(ok331)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
F07H5.2, K08F8.6. Homozygous sterile deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok331 homozygotes (grotty sterile Dpy with vulval blip). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: TGAAAATTGGGAGTTCGGAG. External right primer: ACCACTTGTTCCTTGCCAAC. Internal left primer: GGACTGGAAACTCCAAGCAG. Internal right primer: GACTGATGAGCCGGTATGGT. Internal WT amplicon: 2637 bp. Deletion size: 1456 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1166 C. elegans +/mT1 II; brc-2(ok1629)/mT1 [dpy-10(e128)] III. Show Description
T07E3.5. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and ok1629 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: CATGGAAACAACAGAAGGGG. External right primer: GAGCCATTTTGAAGTTTGGC. Internal left primer: CGGCGTTTCTTCTTGTCTTC. Internal right primer: AAAATCAGGTTTTCATGGCG. Internal WT amplicon: 3006 bp. Deletion size: 809 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1167 C. elegans sulp-6(ok1586) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
W01B11.2. Apparent homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok1586 homozygotes (probable early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TGGTTGGAACAGTTGTGGAA. External right primer: TTCATGTCTATTCGCCCACA. Internal left primer: TGGCTCAACAAATGGAACAA. Internal right primer: TTCGGTATTTCCGCATCTTC. Internal WT amplicon: 3052 bp. Deletion size: 1653 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1168 C. elegans bbs-2(gk544) IV. Show Description
F20D12.3. Superficially wild type. External left primer: ATGGTCCGTGAATCCAATGT. External right primer: CTTCAAAAAGTCCCTCTGCG. Internal left primer: CCATGGCAACATGTAAGCAC. Internal right primer: TTATGTGAGGCTTCGACACG. Internal WT amplicon: 1741 bp. Deletion size: 712 bp. Deletion left flank: GATAATGTCGAACTTGCAAATGTATTTTCG. Deletion right flank: TTAAAAGAAAGACAATGGAGAATCAAGTCA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1169 C. elegans ent-2(ok235) X. Show Description
K09A9.3. Homozygous. External left primer: TTGCCTAGCAGACGTTCCTT. External right primer: TGAGGAAAAATCCAGCCATC. Internal left primer: GCTACCGTCTGACCTACCCA. Internal right primer: CACCTGAGCCTTTGATGGAT. Internal WT amplicon: 3315 bp. Deletion size: 1475 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1171 C. elegans parp-2(ok344) II. Show Description
E02H1.4. 1576 bp deletion. Flanking sequences: GAGGAACCGGAACCTGAGCCGAAAGTTGAT TTAAACCTGTTAATCCAATGATACTCCTCA. External left primer: CCGCAGTACACCTTAGCCTC. External right primer: ATCCTGCTCGTCAAGCATCT. Internal left primer: GTGAAAGCCTGGAGAGCAAG. Internal right primer: ACGACACTTCAGATGGGCTT. Internal primer WT PCR product: 2610. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1179 C. elegans F08B12.1(gk545) X. Show Description
F08B12.1. External left primer: CTCCTCCTACACCCTCTCCC. External right primer: CGCTAAGCTTGTGTTGGTCA. Internal left primer: GAAGCCGCTAGAAGAACGTG. Internal right primer: ATTTAGGTACGCGCGAGAAA. Internal WT amplicon: 2016 bp. Deletion size: 569 bp. Deletion left flank: CCTTATAAATCCGCGGAGCAATACAAATGT. Deletion right flank: ATCTTCGCAAATCAACTCAGCAAACACTTG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1180 C. elegans gex-2(ok1603)/dpy-9(e12) IV. Show Description
F56A11.1. Homozygous lethal deletion chromosome balanced by morphological marker. Heterozygotes are WT, and segregate WT, Dpy (dpy-9 homozygotes), and ok1603 homozygotes (probably sterile adult with protruding or ruptured vulva). Pick WT and check for correct segregation of progeny to maintain. External left primer: AGTCACCCTCTCTCCCACCT. External right primer: AAGCAGTGGGTTGAAAAACG. Internal left primer: CAGCTGAAAAATGAACGCAA. Internal right primer: GTGTTGGCCGCTGTATCTTT. Internal WT amplicon: 2748 bp. Deletion size: 1903 bp. Deletion left flank: AAACATACCAGATGTTTTGCAGCTTCTCGA. Deletion right flank: GCAAATTTGGCAAATTTGCCGAGCTCGGCA. Insertion Sequence: ATTTGGCAAATTTGGCAAATTTGCCGGCAAATTTGGCAAATTTGCCTA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1181 C. elegans mau-8(ok1592) IV/nT1 [qIs51] (IV;V). Show Description
Y62E10A.8. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok1592 homozygotes (thin twitcher, late larval or sterile adult arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TTTTTCCGGGTTTTACTGGA. External right primer: AGGAGAATGGGAGGCTCTTC. Internal left primer: GCGGGTTACTGTAGCAGCTC. Internal right primer: TCACTTGCATATCCACCAGC. Internal WT amplicon: 2234 bp. Deletion size: 593 bp. Deletion left flank: CCTTTTTTGATTTTTTAGAAAAAAACTTTT. Deletion right flank: TGTGAATATTTGACACGAATCGTTAAGATT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1182 C. elegans C07E3.5(gk550) II. Show Description
C07E3.5. External left primer: GTCGTCGTTTTTGTTGCTGA. External right primer: ATTTCCTGCAAAACATTGCC. Internal left primer: CCGAATTTGAATTACCGCAT. Internal right primer: GCCAGAAGCTTCCAGTTCAA. Internal WT amplicon: 1894 bp. Deletion size: 873 bp. Deletion left flank: CCTCTGGTAATTCTTCACCCATCTGAAGTC. Deletion right flank: AGATATTAATTTTTAAAATATGAAAACTAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1183 C. elegans sma-9(ok1628) X. Show Description
T05A10.1. External left primer: AACCATCATGAAAGGCCAAG. External right primer: TTGTTGCGACAGATACGGAG. Internal left primer: CCAGGGAACAATCAGCAAGT. Internal right primer: TGCTCCTGACCAAACTTGAA. Internal WT amplicon: 2299 bp. Deletion size: 1100 bp. Deletion left flank: AGCTGGAATGACTTCAAGAACTCATCGTAC. Deletion right flank: GTGGTCGTGGGCGTGGAAGATATATTTGTG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1184 C. elegans T24H10.7(gk551) II. Show Description
T24H10.7. External left primer: GATCGAGGAAATTCGGCATA. External right primer: CGTCACCATGTGAGGAAATG. Internal left primer: CATGCGCATTCCTTCTATCA. Internal right primer: TCAAACCATAACGGCATTCA. Internal WT amplicon: 2262 bp. Deletion size: 1430 bp. Deletion left flank: GGAGAGAGGCTTAGACATTTACACATGTGA. Deletion right flank: CAGGGTAGATTGTATTGTTTCGTTTTTTCT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1186 C. elegans haf-3(gk549) V. Show Description
F57A10.3. Superficially wild type. External left primer: AACCGGTTCTTGTCCAACTG. External right primer: CTACACCTCCCTGGCAATGT. Internal left primer: ACGACGCCAATATGATGGAT. Internal right primer: GAACGTCTTTCTTCCGTTCG. Internal WT amplicon: 1973 bp. Deletion size: 1141 bp. Deletion left flank: TTTTTTAATAAGTTTAATCACATTTTTCGG. Deletion right flank: GTAATTTCTCTTTTTTTTTAAAAAGACTTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1187 C. elegans C30F8.3&Y110A7A.20(gk548) I. Show Description
Y110A7A.20, C30F8.3. External left primer: CTCCAAGTTCTGCATCGTCA. External right primer: ATCCCGTTCCTGTGTGTTTC. Internal left primer: GGTAACGCCACGAAGACATT. Internal right primer: TCCGTTTCAACAACATTTGC. Internal WT amplicon: 1843 bp. Deletion size: 878 bp. Deletion left flank: GAACCCTTGTGTTTTGGGCTGGCACGATGT. Deletion right flank: CTTAGGCTTATTGATCCAGGTAGATTTATT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1188 C. elegans T06G6.3(gk546) I. Show Description
T06G6.3. Superficially wild type. External left primer: GTAGGCGCTAAAACGACTGG. External right primer: AAATATTTTCCCGCCATTCC. Internal left primer: GAAATAAGGCGAGATGCAGG. Internal right primer: AGGCAAAGTCGAAGGTGAAA. Internal WT amplicon: 1775 bp. Deletion size: 808 bp. Deletion left flank: ACTAACCGGGGATTTTCGCTTCTCCGCGGC. Deletion right flank: AATTTTTGTTTATTTCAGAAGTAACATTAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1189 C. elegans F53H10.2(gk547) V. Show Description
F53H10.2. External left primer: GCACTTTCTAGGCGGAACTG. External right primer: GTGTATGAATGGTCGGGGTC. Internal left primer: CTGAAGTGGTGGAGGTGTCA. Internal right primer: TCCTGTTGTTGGTTGAGTCG. Internal WT amplicon: 1685 bp. Deletion size: 1280 bp. Deletion left flank: TATTTTATAGGAAACACTATGTTTATTAAT. Deletion right flank: TAAGTTCAGTGTGGCAGAGTAGTCTCCAGC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1190 C. elegans ceh-27(ok1655) V/nT1 [qIs51] (IV;V). Show Description
F46F3.1. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1 aneuploids, and non-GFP ok1655 homozygotes (embryonic or early larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CGGAGGATAGTTTGCAGGAG. External right primer: CTCTTCCCCTCCGATACCTC. Internal left primer: AGCTGCAGTCAGAAGTGGGT. Internal right primer: AATCCCAGTTTCTCGCCTTT. Internal WT amplicon: 2753 bp. Deletion size: 1273 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1191 C. elegans pab-1(ok1656) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Y106G6H.2. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok1656 homozygotes (probable early larvarl arrest ). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TTCGTTTGCGATTCATTTCA. External right primer: CTAGACGTCGCCTGACTTCC. Internal left primer: GTTCAACATGTGTTGGTCCG. Internal right primer: GACCCAACTCCTCACCCATA. Internal WT amplicon: 2732 bp. Deletion size: 1938 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1192 C. elegans unc-89(ok1659) I. Show Description
C09D1.1. Superficially wild type. External left primer: TCAAGTTCTTTTCGGGTTGG. External right primer: AGCGAAAGAGCAGCATGATT. Internal left primer: TCAAACAGCGCATGAAAAAC. Internal right primer: TACCCAAAAACGGAAAATCG. Internal WT amplicon: 2637 bp. Deletion size: 923 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1193 C. elegans C34D1.2(gk552) V. Show Description
C34D1.2. Superficially wild type. External left primer: GCGTATGCTCACTTGCTTCA. External right primer: TGGAAACCAGCACAACAAAA. Internal left primer: TTTGATTGTATGTGTCCCGC. Internal right primer: CAATTTGGAAGCTGGGAAAG. Internal WT amplicon: 2086 bp. Deletion size: 1543 bp. Deletion left flank: AAAATATATAAGGAAAGTACAATTAAATAA. Deletion right flank: TGTTGTTGTGTGTACCTGAGTATAAGCAAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1194 C. elegans nhr-158(gk553) V. Show Description
C17E7.6. Superficially wild type. External left primer: CCCGCATCTCTTTTGGATAA. External right primer: GCCAGTCGGAAATAACCAGA. Internal left primer: TTTGTCCAAATATGTCCGCA. Internal right primer: AGCCCTGTTTCTATCGCAGA. Internal WT amplicon: 1728 bp. Deletion size: 1091 bp. Deletion left flank: CCAAATTCAACAAAAGATCGACAGTGGTGT. Deletion right flank: ACACACTTCCTCTGCGGTATATCGATTGAG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1196 C. elegans K02F3.10&rnp-5(ok1634)/sC1 [dpy-1(s2170)] III. Show Description
K02F3.11, K02F3.10. Apparent homozygous lethal deletion chromosome balanced by dpy-1-marked recombination suppressor. Heterozygotes are WT, and segregate WT, Dpy (sC1 homozygotes), and ok1634 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: TTTGTCCAAAAAGTGCCTCC. External right primer: AGGCGCTCTTGATTCACAGT. Internal left primer: TATCGGATAACAAAAGGCGG. Internal right primer: AGCAGCTCGTCCAGTAGCTC. Internal WT amplicon: 2252 bp. Deletion size: 1401 bp. Deletion left flank: GTTCCTGAAACAAAAATCGGTGATAAAAAT. Deletion right flank: CGATTTGTCCTCCATCCATGTGCTTGATCG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1197 C. elegans dao-3(ok1678) X. Show Description
K07E3.3. Superficially wild type. External left primer: GCTCACGCTCAAAACATGAA. External right primer: TCTTCTCATCACTCCCCCAC. Internal left primer: TGATTTGTTCGATGTTGCGT. Internal right primer: TTTTTCACTCTGTCCCCCAC. Internal WT amplicon: 2639 bp. Deletion size: 1500 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1198 C. elegans Y39G8B.1(ok1682) II. Show Description
Y39G8B.1. Superficially wild type. External left primer: TAGGCAAACCGGCAATTAAC. External right primer: TGGCCCATTATTTCTCATCC. Internal left primer: CCCATCAATTGCCTGAATCT. Internal right primer: GCCCCCAAGTTCAATATCAA. Internal WT amplicon: 2251 bp. Deletion size: 892 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1199 C. elegans T26C11.4(ok1680) X. Show Description
T26C11.4. Superficially wild type. External left primer: CCAGACATTTGTCGCAGAGA. External right primer: AATTCAAAGTTCCGCCAAGA. Internal left primer: AGTATTGGCACGGACGAATC. Internal right primer: CAGATGGACATCAGCCATTG. Internal WT amplicon: 3154 bp. Deletion size: 685 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1200 C. elegans jun-1(gk557) II. Show Description
T24H10.7. Superficially wild type. External left primer: GATCGAGGAAATTCGGCATA. External right primer: CGTCACCATGTGAGGAAATG. Internal left primer: CATGCGCATTCCTTCTATCA. Internal right primer: TCAAACCATAACGGCATTCA. Internal WT amplicon: 2262 bp. Deletion size: 1168 bp. Deletion left flank: CATTAGCCGACGATTTTTGTGACTAACTGC. Deletion right flank: ATTTTTTTAGCATTCAATTCAAATTCAATT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1201 C. elegans unc-89(ok1658) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
C09D1.1. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok1658 homozygotes (probable early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TCAAGTTCTTTTCGGGTTGG. External right primer: AGCGAAAGAGCAGCATGATT. Internal left primer: TCAAACAGCGCATGAAAAAC. Internal right primer: TACCCAAAAACGGAAAATCG. Internal WT amplicon: 2637 bp. Deletion size: 1274 bp. Deletion left flank: TCCTATCATCTATTTCATTCGATCAAACAA. Deletion right flank: ATTTTGGGGGGGGGGGGGGGCAGAAATCGG. Breakpoints should be confirmed; deletion may also involve insertion and/or rearrangement of sequence between external left and internal left primers. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1203 C. elegans +/mT1 II; apc-2(ok1657)/mT1 [dpy-10(e128)] III. Show Description
K06H7.6. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and ok1657 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: TCACGCAAAATACGCAAAAA. External right primer: GGAAGTGCTGATTTGGCAGT. Internal left primer: ATGACGACAGTTCTGCAACG. Internal right primer: GGCTGACGATCTCTTGGAAA. Internal WT amplicon: 3306 bp. Deletion size: 650 bp. Deletion left flank: CCTAAATTATATATAACATTTTCAGAAAAA. Deletion right flank: GACCTGACACTGTACAACAAATTATCAGTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1204 C. elegans nhr-34(gk556) IV. Show Description
F58G6.5. External left primer: CACCATCACATCCAGCTTTG. External right primer: TCGATTTTGTATTCCCTCGC. Internal left primer: TCGGCACCAAGCAATATGTA. Internal right primer: AAGCTTCTTGCGCTTTGAAC. Internal WT amplicon: 1669 bp. Deletion size: 1067 bp. Deletion left flank: ACATCAACTCTGCACAATTGATCGAATTCC. Deletion right flank: TACTATCTCAGATAATTTCTCTGTAACATT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807