More Fields
Strain Species Genotype
VC1534 C. elegans elt-6(gk723) IV. Show Description
F52C12.5. External left primer: ACCTCCTCCTCCGACAACTT. External right primer: GGTTCCTGCTGCTTTGACTC. Internal left primer: CCTCCCACCACTTTGTCATT. Internal right primer: GTAGGCATGGCAGCTCTTTC. Internal WT amplicon: 1787 bp. Deletion size: 457 bp. Deletion left flank: ACTTCTACCCAAGTATAACTAAAAAAAAGA. Deletion right flank: TTTCGCAGCATTTTCCCGCCGCCTGACAAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1535 C. elegans vha-7(ok2015) IV/nT1 [qIs51] (IV;V). Show Description
C26H9A.1. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok2015 homozygotes (early larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CAACGCCTACAGTGCTCAAA. External right primer: TGAGCAGCATCACCAAACAT. Internal left primer: TGACGACGGTTTCCACAATA. Internal right primer: TCTCCAAAATGCCTACCTGG. Internal WT amplicon: 2817 bp. Deletion size: 1865 bp. Deletion left flank: AATTTCTCGATTTGAACAACAATGATTATG. Deletion right flank: AAGTTCGAATTTTTAGTCAGAATTTGGCGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1536 C. elegans spp-10&hlh-12(ok1923) IV/nT1 [qIs51] (IV;V). Show Description
C28C12.7, C28C12.8. Homozygous sterile deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok1923 homozygotes (sterile adult). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TCCCTTCCATAAATCGCTTG. External right primer: CGGTGTCGAATGAAGGTTTT. Internal left primer: GAGCCGCAATGAAAAACAAC. Internal right primer: GACTGCGGTCAAACTGACAA. Internal WT amplicon: 2109 bp. Deletion size: 939 bp. Deletion left flank: ACTAAAAAAATTCAAGAAAATGTTAATTTT. Deletion right flank: AGTGCCATGGAGAAATTCTTCGAAAACTCA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1537 C. elegans isw-1(ok1951) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
F37A4.8. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok1951 homozygotes (sterile adult). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TCTGCTCGATCACGTCAAAC. External right primer: AGAAATCCGGCAAGCATCTA. Internal left primer: TACAGCTTGCCGGAAAAATC. Internal right primer: TAAACGCCCGAGGTAATTTG. Internal WT amplicon: 2817 bp. Deletion size: 1866 bp. Deletion left flank: TTTCTGGGCTTCCGACATACGACCTTGTTG. Deletion right flank: GCGGCGTCGGACGATTCCGGTTCATCGTCC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1538 C. elegans vha-7(ok1952) IV. Show Description
C26H9A.1. Viable, fertile, slow-growing, sometimes sterile. External left primer: CAACGCCTACAGTGCTCAAA. External right primer: TGAGCAGCATCACCAAACAT. Internal left primer: TGACGACGGTTTCCACAATA. Internal right primer: TCTCCAAAATGCCTACCTGG. Internal WT amplicon: 2817 bp. Deletion size: 1749 bp. Deletion left flank: ATTTGAAAACTTTTCTGAAAGTCTCACAAT. Deletion right flank: GTATTTCAAAGTATTGTTGATTCATATGGT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1539 C. elegans hpd-1(ok1955) III. Show Description
T21C12.2. Superficially wild type. External left primer: TTGTGGCTGTGCACATTTTT. External right primer: AACATCCCCGTAGCCATTCT. Internal left primer: CGGCAATTTGTCAAAAATCA. Internal right primer: AAAACAGGAAACCGTTGTGG. Internal WT amplicon: 2256 bp. Deletion size: 1363 bp. Deletion left flank: TAATTCAGAACTCGGAAATCACCTTGTTCA. Deletion right flank: GCCCGTGGCTGTGAATTCCTTTCCATTCCA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1542 C. elegans F58B3.7(ok2027) IV. Show Description
F58B3.7. Superficially wild type. External left primer: TCACTTTCGCTAGCATCCCT. External right primer: GGATCATCATTCGGACAAGG. Internal left primer: TCAATTCACTGTCCGCATGT. Internal right primer: GGAGGACGTTCTGACTTTGG. Internal WT amplicon: 2208 bp. Deletion size: 1136 bp. Deletion left flank: CCGTATTTTTGGGTCTGGGTAACAAAGTCT. Deletion right flank: TTAATTATCAACTTTGTTTAACAGTTTATA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1543 C. elegans sea-1(gk1023) II. Show Description
F19B10.9. External left primer: ACCGTCACGAATGAGGTTTC. External right primer: CTCTTGCCGACTTCGTTTTC. Internal left primer: TGCCTGAGCAATTTCCTTCT. Internal right primer: TTATATTTGCGGTGCTGTGC. Internal WT amplicon: 2319 bp. Deletion size: 2143 bp. Deletion left flank: GGAATGTTGCCTGAGCAATTTCCTTCTTTT. Deletion right flank: GCTAGAATTGTAGGCAATTGTCGATTTCAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1544 C. elegans C12D12.5(gk700) X. Show Description
C12D12.5. External left primer: GCACTGTTGCTGTCCACACT. External right primer: CAGGATTGCAAGTTACGGGT. Internal left primer: AACTTTCTCGTGCTCCTCCA. Internal right primer: AAATGCGCTTTACCACCAAC. Internal WT amplicon: 2128 bp. Deletion size: 1031 bp. Deletion left flank: ATCTGAATCGTTGACTTGCTCAAACGATTT. Deletion right flank: GAATAAAGGTATAATGTGTAAATGAAGCTA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1545 C. elegans nhr-142(gk826) V. Show Description
F44E7.8. External left primer: CAACGTCAGTTGCATCGTCT. External right primer: CACCTCTTGTCGTTTCCCAT. Internal left primer: TCGTGAATTCAGGGAGAACA. Internal right primer: TCACTCCAACTCGCACAGAC. Internal WT amplicon: 2183 bp. Deletion size: 1107 bp. Deletion left flank: GAAACATAGTTTTTGTGACTCATAAGACGC. Deletion right flank: AGATTGTGTCTGTGCGAGTTGGAGTGAGAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1546 C. elegans nhr-134(gk722) V. Show Description
F44C8.2. External left primer: AAATGCCGAATTACTCGTCG. External right primer: TCAAAAACGCAGCAGACATC. Internal left primer: GCAGATTTGAGATTGCGGAT. Internal right primer: CAGAAGCGATTCTTCTTGCC. Internal WT amplicon: 1783 bp. Deletion size: 915 bp. Deletion left flank: CCAAAAAACTTCGGGACGCCATTTTGGAGT. Deletion right flank: AAAAGAGTTAGTCAAATTTCTTGAAGCTTC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1547 C. elegans nhr-285(gk698) V. Show Description
T26E4.16. External left primer: AGAAGCCGACCACAAAACAG. External right primer: ATTTACGCGCATATTTTGGC. Internal left primer: ATATATGACGGCAGCCCAAA. Internal right primer: AGGAGCTCCAACGTGCTCTA. Internal WT amplicon: 2370 bp. Deletion size: 886 bp. Deletion left flank: AAACATGAGCTTTCAAATGAAACATGTTTC. Deletion right flank: TTCTGGATTGCCACCATCATCTATTTTGAT. Insertion Sequence: T. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1548 C. elegans fbxb-1(ok2052) V. Show Description
T26H2.1. Superficially wild type. External left primer: AACCGGAAGGTTCTCCAAGT. External right primer: TGTACAAGAAGACGACCCCC. Internal left primer: TCTTCCCGATTGATGACTCC. Internal right primer: AAACTTCCGGCAAATTGATG. Internal WT amplicon: 2121 bp. Deletion size: 1037 bp. Deletion left flank: TTTAAACGTTTTTTTTTAACTTCTCTCTTT. Deletion right flank: GGAATGAGGTGGATTTTGAGAACAATCCAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1549 C. elegans pfd-5(gk706) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
R151.9. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP gk706 homozygotes (sterile adult). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: ATGGAACTGGTGCTTTTTCG. External right primer: ACATTGCAGGGAAACAAAGG. Internal left primer: ATAGCAGCGAGACAAGCACA. Internal right primer: TTGAATTACCGCCAACAGTG. Internal WT amplicon: 1648 bp. Deletion size: 587 bp. Deletion left flank: TCGCAGTTTGTCACCGGTTGAACTCTCATT. Deletion right flank: CCTGCAGTTGCAATTTTCACATCGTCCAAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1550 C. elegans nhr-166(gk688) II. Show Description
C49D10.2. External left primer: CACCATACCGATTTTCGCTT. External right primer: GTGATTATCGCTTTTCCCGA. Internal left primer: TGAAACCAATTGTACCAGCG. Internal right primer: CAGATCACAATGATGCCCAG. Internal WT amplicon: 2288 bp. Deletion size: 762 bp. Deletion left flank: GCAGGTAGATAGGTAGGCAAGTAGGTAGAA. Deletion right flank: CAACTAATCACTCAAGACCATCGAAATGCT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1551 C. elegans nhr-117(gk729) V. Show Description
F16B4.12. External left primer: CATACGGCAAGTTCAGCAAA. External right primer: CTACCAACCTGGTCATGGCT. Internal left primer: TCGGGATTTGACAAGTTCGT. Internal right primer: GCCGACTGTTGTCAGGATCT. Internal WT amplicon: 1781 bp. Deletion size: 1203 bp. Deletion left flank: AAATATTCCTGCAATCTTATATTTTTCACA. Deletion right flank: GCGTTTTGAATAGACGTTAGACAGCGTGCG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1552 C. elegans nhr-283(gk724) V. Show Description
F57A10.6. External left primer: TGCACTAAAAGGCTGCAATG. External right primer: TTCGATTTTTATTTTGCGCC. Internal left primer: GTCGTGGCTCAATGAGGTTT. Internal right primer: CTCAAGTTAATCCCAGGCCA. Internal WT amplicon: 2348 bp. Deletion size: 1027 bp. Deletion left flank: GCCTACCTGCCTACGATGCTCCCACCTACT. Deletion right flank: CATTCAAGAAAAATTTAGGTGCTTAAAAAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1553 C. elegans dnj-19(gk650) V. Show Description
T05C3.5. External left primer: TTTGGCATTCCTTTTCCAAG. External right primer: CGGCCAAACATTTTTGAAGT. Internal left primer: TCCTCTGATGACTCCTGGCT. Internal right primer: CTTGACACACGAATTCTCGG. Internal WT amplicon: 2058 bp. Deletion size: 336 bp. Deletion left flank: TGATGTTTTTCCGACGTAAAGCTCTTCGAG. Deletion right flank: AGCAAGTTTGAAGTAAGATTTCTTAATGTC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1554 C. elegans nhr-155(ok2026) V. Show Description
C14C6.4. Superficially wild type. External left primer: GGTTCGGTGCAAGGAAATTA. External right primer: TGCGAATTTTGGTGTTTTGA. Internal left primer: AGTACAACGGAGGTGAACGG. Internal right primer: TTTCGAGCACGATTTCACAA. Internal WT amplicon: 2276 bp. Deletion size: 1738 bp. Deletion left flank: AGAAATTAGTCTTGTTTGAATTTTCATATT. Deletion right flank: AATCAGCTCCGCGCTCAGAAAATATTACAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1555 C. elegans F13C5.2(gk716) X. Show Description
F13C5.2. External left primer: GCAAAATCTTTGTTGGGGAA. External right primer: TCGCCGATCAACTTCTTTCT. Internal left primer: CATTCTGCCATTTCCTTCGT. Internal right primer: CGTCAACTGGCTTACGGAAT. Internal WT amplicon: 1651 bp. Deletion size: 385 bp. Deletion left flank: CTCTGTTCTCTCAGCGGTGGCCAGTGTGTA. Deletion right flank: ATTACTCAGAACTATAAAAACAACATTACA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1557 C. elegans nhr-86(gk717) V. Show Description
Y40B10A.8. External left primer: AACCCAAAAGTTGCATGAGG. External right primer: AAAATTGGCCAGAAATGACG. Internal left primer: TCTGGCTTGATTTCTCGCTT. Internal right primer: CGCATGAGAACTGCAAGAAG. Internal WT amplicon: 1750 bp. Deletion size: 445 bp. Deletion left flank: AAAATTCAAAAAATTTTCTAAGTTTTATAT. Deletion right flank: AATAATTATTTTAACTCACTCGCAGTAATC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1558 C. elegans cyp-13B2(gk726) X. Show Description
K06G5.2. External left primer: TCACCCACGGACATGTAAGA. External right primer: TTTGGGCAGGTACAAACACA. Internal left primer: CTGATTGCGAGGAACAACAA. Internal right primer: GTGAACAGCGGTCTCACAAA. Internal WT amplicon: 1832 bp. Deletion size: 1291 bp. Deletion left flank: TTTGATGCCCTTTCAATGAGAAAACACCTT. Deletion right flank: AGTACAAGTAATTTCAGGTACTATCAGGAA. Insertion Sequence: AGG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1560 C. elegans cnd-1(gk718) III. Show Description
C34E10.7. Unc, sometimes with rounded nose. External left primer: GTTGCGGACAACACACATTC. External right primer: CATGTTAATCGGTGACACGC. Internal left primer: ACGTACTCGATATCTCGCCG. Internal right primer: GTGGAACACCATTCCACACA. Internal WT amplicon: 2138 bp. Deletion size: 1438 bp. Deletion left flank: TACTCGATATCTCGCCGCGATCGTACCGTA. Deletion right flank: TACTCTCTGAGCATATCCAATGCATTATTC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1561 C. elegans nhr-175(gk720) V. Show Description
F09F3.10. External left primer: CCCGACTCACGGTAGAACAT. External right primer: AACGACCAAAAATGCGAAAC. Internal left primer: ATATTTGTCGCAGCGCTCTT. Internal right primer: AATTGGAATGGGCTGAACTG. Internal WT amplicon: 2080 bp. Deletion size: 778 bp. Deletion left flank: ATGGAGATTGTTTGATCAATTACGGTAAGT. Deletion right flank: ATCTGATGTGAACAAAGTGTTAAAATGGAG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1562 C. elegans nhr-109(gk712) II. Show Description
T12C9.5. External left primer: TCGAGGCACAATGTCAAAAG. External right primer: AACTGATGGCTCTGCGACTT. Internal left primer: AGAGACATTCTGGAGTGGCG. Internal right primer: ACAAGGCCAGTATCCCAGTG. Internal WT amplicon: 2434 bp. Deletion size: 1587 bp. Deletion left flank: CTGTTTTGGTTTTTAAAATTTTTTTAAATT. Deletion right flank: GGTGTCCTCTTGTTTTGATGAGTTTCGAAC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1563 C. elegans nhr-229(gk713) IV. Show Description
Y116A8C.18. External left primer: CAAAAATGTTTTGTGCGTGG. External right primer: TCAAATCTGCGTGCTCATTC. Internal left primer: AATTACCCGCATGTTTGAGC. Internal right primer: CCGCTCAGAAATCATTCGTT. Internal WT amplicon: 1761 bp. Deletion size: 593 bp. Deletion left flank: GGCCACTTCCGATTTTAACAATCTTTCTGA. Deletion right flank: GAAACAGTTTTTTAACCAACCTTGTCTTCA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1564 C. elegans cyl-1(ok1943) V. Show Description
C52E4.6. Superficially wild type. External left primer: GAAGAGGATGGGGAGAGGTC. External right primer: GCAATTTTCGCCTGTCAAAT. Internal left primer: CCCCAAAATGACACAAATCC. Internal right primer: GAAGCGCCTCTTCTGAATTG. Internal WT amplicon: 3228 bp. Deletion size: 1511 bp. Deletion left flank: TTCTTCTTTCGGAGTTGATCATCTGAAAAT. Deletion right flank: ATTTTGTTCTTTTGGCTAAAAATACATAAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1565 C. elegans nhr-116(gk728) V. Show Description
F09C6.9. External left primer: ATTCCTCCTACTCCCTCCGA. External right primer: TAGGGCATTCTTTCATTGGC. Internal left primer: ATCTGTGTCTCTTCGCCCAT. Internal right primer: TCGATCAGCAAACCCTATCC. Internal WT amplicon: 2056 bp. Deletion size: 923 bp. Deletion left flank: TCAGATTTGTTCAATTGTTCTTCTCTCTTA. Deletion right flank: ACGGGTGCAAAACATTTTTCCGGAGGATGT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1566 C. elegans F31B9.2(ok2066) X. Show Description
F31B9.2. Superficially wild type. External left primer: CGACAACTCAACCATCGAAC. External right primer: CGAACGGAGCTAGGAACAAG. Internal left primer: CTGCTGATCCAGTCCAACAA. Internal right primer: AACCGATGGGAAATTCACTG. Internal WT amplicon: 2279 bp. Deletion size: 850 bp. Deletion left flank: CAAATAGCATCCCATTTGAACTGTTCTCGC. Deletion right flank: GATGGAAAAAGAAAACGAAATGCTCAGCAG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1569 C. elegans bbs-2(ok2053) IV. Show Description
F20D12.3. Superficially wild type. External left primer: ATGGTCCGTGAATCCAATGT. External right primer: CTCAACTGAGCAGCTTGTCG. Internal left primer: CCATGGCAACATGTAAGCAC. Internal right primer: CTGCAGCATCGTTAGCTTTG. Internal WT amplicon: 3305 bp. Deletion size: 2306 bp. Deletion left flank: AACGGATGAAATAACATGTTTGGCTCATGT. Deletion right flank: GTGAAAGAGATTATCATTCGTGCTGAAGAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1571 C. elegans K11D12.6(ok2024) V. Show Description
K11D12.6. Homozygous viable deletion, detectable by nested PCR. External left primer: CACGTGCAGAAGAGGAATGA. External right primer: GTTGCGACACGAGAATCAGA. Internal left primer: TTCAGGGCAGATTTACGACC. Internal right primer: GGCACAATAAAAGGAAGCCA. Internal WT amplicon: 2290 bp. Deletion size: 1074 bp. Deletion left flank: GGGATGTTCTTTTCTTACTGTTGTGAAAAT. Deletion right flank: GGCTTCCTTTTATTGTGCCAAATTATATGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1572 C. elegans nsy-4(ok2054) IV/nT1 [qIs51] (IV;V). Show Description
Y38F2AL.1. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok2054 homozygotes (probable embryonic arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: ACATGGTGCATCAGTCAAGC. External right primer: AAGCCTAAGCAAGCGCATAA. Internal left primer: GTGGAAGTCATGGTGTGGTG. Internal right primer: ATGCTGAAACCATCCGAGTC. Internal WT amplicon: 2842 bp. Deletion size: 1574 bp. Deletion left flank: AACCTCTCAAGATGTCCAAAATCTAATTTC. Deletion right flank: CAGCTCTCCTCTCCGCGATTGCCGAAGGAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1575 C. elegans cgh-1(ok492) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
C07H6.5. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok492 homozygotes (sterile adult, tends to explode at vulva). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GGCAGCTCGAAAATATTGCC. External right primer: GGAAAACCGCAAGGATGGTGG. Internal left primer: TCACGGAGCTAGATGTGACG. Internal right primer: CGTCAAAAAGAACCCGATGT. Internal WT amplicon: 3095 bp. Deletion size: 1043 bp. Deletion left flank: GAGAACATACACAATCTGGACGAGATCACT. Deletion right flank: CCTGGGGTGGCGATGACCAAGTGAACCGTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1576 C. elegans F46H5.4(gk701) X. Show Description
F46H5.4. External left primer: GGACGAAGTGAACGAAGAGC. External right primer: AACAAGGTCAATGTTTCGGC. Internal left primer: GTCCGGTGCAAATTCAGATT. Internal right primer: GACAGCCGCACAGCTCTAGT. Internal WT amplicon: 2100 bp. Deletion size: 1294 bp. Deletion left flank: ATTATTATTATTATTATACGTAAACTCGGA. Deletion right flank: GAAGAGAAGGAAGAATAACGCAGCAGGCCA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1578 C. elegans Y38H8A.4&Y38H8A.3(gk727) IV. Show Description
Y38H8A.4, Y38H8A.3. External left primer: TACGCGAGAAGCCAAAATCT. External right primer: GGAGAGCTTGTTGAGAACGG. Internal left primer: GCCGCTATTTCTGGAGATCA. Internal right primer: TACGATTATTCGCGCATTGA. Internal WT amplicon: 1637 bp. Deletion size: 1192 bp. Deletion left flank: TTGATCACCTTCGCCGCCACTTCAAGCTTC. Deletion right flank: TTGTACAGGCCTATTTCTCAGATTAAGCCT. Insertion Sequence: GAAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1579 C. elegans ebp-2(gk737) II. Show Description
VW02B12L.3. External left primer: AAACCATGTATGGGAACCGA. External right primer: GGAGTCGGCTTGTTTCAGAG. Internal left primer: AAACTTCTGCTCAAGAGGCG. Internal right primer: TAATGTGGAAATCGATGGCA. Internal WT amplicon: 1627 bp. Deletion size: 541 bp. Deletion left flank: TTCGCCCTTCCACCATTGTGGTGAGACTTC. Deletion right flank: CGTCTGGAGCCGCGTACTGTCAGCTCACTC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1580 C. elegans mksr-1(gk738) X. Show Description
K03E6.4. External left primer: GAAGGGCAAATCGATGAAAA. External right primer: GATTCAACGGGTGCTTCTGT. Internal left primer: ATTGGATTCTTCCGGGAACT. Internal right primer: CTAACAGGTTCGAGGCGAAG. Internal WT amplicon: 1986 bp. Deletion size: 921 bp. Deletion left flank: ATTGCTCGGCACATTACAGCGAAAAAAGTT. Deletion right flank: ATTACAATACATTTGTAAAATTGTAAAATC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1581 C. elegans mksr-1(gk739) X. Show Description
K03E6.4. External left primer: GAAGGGCAAATCGATGAAAA. External right primer: GATTCAACGGGTGCTTCTGT. Internal left primer: ATTGGATTCTTCCGGGAACT. Internal right primer: CTAACAGGTTCGAGGCGAAG. Internal WT amplicon: 1986 bp. Deletion size: 1241 bp. Deletion left flank: AATCGACTTTTTGGAGTTTTTTGGCAAATA. Deletion right flank: TACATCAAAAAAAATACTGTGATAAAAATT. Insertion Sequence: A. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1582 C. elegans R10F2.5(gk699) III. Show Description
R10F2.5. External left primer: GAGGTTCTCACCTGCTCTGG. External right primer: ACGAGCTGGATTCGCTTAAA. Internal left primer: GGCGAGGAATCCTAACATGA. Internal right primer: AAACGACAAGCAGTGGCTCT. Internal WT amplicon: 1931 bp. Deletion size: 581 bp. Deletion left flank: CGGGGAGAAGAGTTATCAAAAAGTTGTAAA. Deletion right flank: TGTATTTACGGGAGTCTGTGTGGGCTTACA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1583 C. elegans cdh-1(gk747) III. Show Description
R10F2.1. External left primer: GAGGTTCTCACCTGCTCTGG. External right primer: ACGAGCTGGATTCGCTTAAA. Internal left primer: GGCGAGGAATCCTAACATGA. Internal right primer: AAACGACAAGCAGTGGCTCT. Internal WT amplicon: 1931 bp. Deletion size: 1004 bp. Deletion left flank: AGAAGCCGAGAAATGAAATGAAATTTAGGTAGAAGGGCCCTGATGTGTGTGTGTGTGTG TGTGTGTGTGTGTGTGTGTGTGTGTG. Deletion right flank: AGAGTTTGGGCTTATTTTTTGAAATTTTCC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1584 C. elegans R10F2.5(gk748) II. Show Description
R10F2.5. External left primer: GAGGTTCTCACCTGCTCTGG. External right primer: ACGAGCTGGATTCGCTTAAA. Internal left primer: GGCGAGGAATCCTAACATGA. Internal right primer: AAACGACAAGCAGTGGCTCT. Internal WT amplicon: 1931 bp. Deletion size: 760 bp. Deletion left flank: CGTTTGAAGTTAGAGGGCGTCAGAGAGTGT. Deletion right flank: TTTGTGTAGATTTACGAGAGTCTGTGTGAA. Insertion Sequence: G. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1585 C. elegans nhr-147(gk741) V. Show Description
C03G6.8. External left primer: CGCCCAGATGAACTTTGTTT. External right primer: TGATTTTCCAAAAGCCCAAG. Internal left primer: CCGTACGGATGTATCTGCCT. Internal right primer: CCAAATTGTTGGCGTTCTTT. Internal WT amplicon: 2189 bp. Deletion size: 762 bp. Deletion left flank: AGTGCTAAAGGCTATCATTATGACGTCATT. Deletion right flank: TCTCCAGAAAATTTGATAATTACTTGAACC. Insertion Sequence: CTTGTTTCATT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1586 C. elegans nhr-225(gk736) V. Show Description
T27B7.2. External left primer: CTTCAAACATTTCCGGGTGT. External right primer: TCAATTATCCGGCAAACTCC. Internal left primer: GGTCGTGTTTCCCAAATTGA. Internal right primer: CCTGCTTGGAAGCCATAGAC. Internal WT amplicon: 2309 bp. Deletion size: 904 bp. Deletion left flank: AGGATAATCACTCATCCAACTAAAATCGAA. Deletion right flank: ACAGAAGCACCTAGAAAAAGGTTTTGTTTA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1587 C. elegans C16C2.4&ocrl-1(gk752) I. Show Description
C16C2.4, C16C2.3. External left primer: TGTTAGCTGCTGAATCACGG. External right primer: TGCACTTGAATCTGGACAGC. Internal left primer: GAAGTCCTTGCCACGGTAAA. Internal right primer: CCTACAATTCCGAGTGCCAT. Internal WT amplicon: 1898 bp. Deletion size: 1465 bp. Deletion left flank: TCTTTCCAGCGTCCTTCGCATATTCAAAAA. Deletion right flank: AAATAAAGAAAATATTAAACAAAATCGTTG. Insertion Sequence: AA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1588 C. elegans nhr-138(gk1018) IV. Show Description
C28D4.9. External left primer: CTATTGTTTCTTGCGTGGCA. External right primer: ACACACAGGACGAATTTCCC. Internal left primer: GAAGCAGGCATGTGTTGGTA. Internal right primer: AGCCCATTTCGATTCAACAA. Internal WT amplicon: 2019 bp. Deletion size: 790 bp. Deletion left flank: AGAGGCATGAGACAACGAAAGCGTATTCTA. Deletion right flank: TTTTTTGAAAGCTTTTCTATTTGCTATTCA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1591 C. elegans nhr-116(gk746) V. Show Description
F09C6.9. External left primer: ATTCCTCCTACTCCCTCCGA. External right primer: TAGGGCATTCTTTCATTGGC. Internal left primer: ATCTGTGTCTCTTCGCCCAT. Internal right primer: TCGATCAGCAAACCCTATCC. Internal WT amplicon: 2056 bp. Deletion size: 810 bp. Deletion left flank: TTTGAATACATTCTCGAAACTCTCTACCGC. Deletion right flank: ATAATCCGGACTGGAACGAAATGGACGGTC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1592 C. elegans nhr-15(gk744) V. Show Description
F33E11.1. External left primer: GGACACACGTTCATAATGCG. External right primer: ACTTGACGGGAATGTTTTCG. Internal left primer: GGGCTCCACATCTTTGCTTA. Internal right primer: ATGTTATGAAGGTGGCCGAG. Internal WT amplicon: 2369 bp. Deletion size: 2143 bp. Deletion left flank: CGTTTGTCCCGTTGTCCCGTTTTTTGAGTG. Deletion right flank: GTGAAATTTGATGCAGATAAAATTTTGTAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1593 C. elegans nhr-229(gk743) IV. Show Description
Y116A8C.18. External left primer: CAAAAATGTTTTGTGCGTGG. External right primer: TCAAATCTGCGTGCTCATTC. Internal left primer: AATTACCCGCATGTTTGAGC. Internal right primer: CCGCTCAGAAATCATTCGTT. Internal WT amplicon: 1761 bp. Deletion size: 722 bp. Deletion left flank: TTTTCTCTGCTTCCCTGCGCGTCCTCAAAC. Deletion right flank: CATTCTCAAATAGAAACAGTTTTTTAACCA. Insertion Sequence: CATTTTCGTAGCGTTTTTCTCTTGCTTTACATCCTTTTCCAAACTTGCGATTCTATAAA TAAAAAATTTGAATGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1594 C. elegans mec-8(ok2043) I. Show Description
F46A9.6. Superficially wild type. External left primer: ATAGCAAGTGTGTGAGGGGG. External right primer: CCGACACAACATTCGACATC. Internal left primer: CCTCGATCGTTGGCTGTTAT. Internal right primer: ATTTCTTTGTCGCCCCTTTT. Internal WT amplicon: 2265 bp. Deletion size: 1117 bp. Deletion left flank: TCGTTGGCTGTTATCTGGAATCCTTGTAGT. Deletion right flank: TGTTGCTCATTGAAAAGAGCTGCTGATTGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1595 C. elegans +/szT1 [lon-2(e678)] I; sup-12(ok1843)/szT1 X. Show Description
T22B2.4. Apparent homozygous lethal deletion chromosome balanced by lon-2-marked translocation. Heterozygotes are WT, and segregate WT, Lon-2 males, arrested szT1 aneuploids, and ok1843 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: TGCAGGTCAATTTCACGGTA. External right primer: CAATGAGGATGTGCAAATGG. Internal left primer: AATGTACGGCCAAGTCCAAG. Internal right primer: TATTGCTGGGACGACAATGA. Internal WT amplicon: 2626 bp. Deletion size: 1803 bp. Deletion left flank: CGCCGAACCAGTAGTTGGTGAGTTTCCTGT. Deletion right flank: CAATGATTTTACTTTTCATTCTATCCAAAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807