F21D12.1. External left primer: CTCTTCTCAGCTCCACCCAC. External right primer: ACCGAGATGCACTTTTTGCT. Internal left primer: ACGCTCTCCGTCTAATCCAA. Internal right primer: ATCACGTGCCTCATTGAGAA. Internal WT amplicon: 2296 bp. Deletion size: 1523 bp. Deletion left flank: AACAATGCGTTTAATGTCAAAAGATTCATC. Deletion right flank: AGTAAACTTTTGTAATGGGTGTTTAAGAAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F44C8.2, F44C8.10. External left primer: AAATGCCGAATTACTCGTCG. External right primer: TCAAAAACGCAGCAGACATC. Internal left primer: GCAGATTTGAGATTGCGGAT. Internal right primer: CAGAAGCGATTCTTCTTGCC. Internal WT amplicon: 1783 bp. Deletion size: 1478 bp. Deletion left flank: AAGTTGATTTTTCCCACCCTGAGATGTATG. Deletion right flank: GTAGATGTGGCAAGGGATATTCTGAAAAGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F47C10.3. External left primer: GAGGTCAATACAACGCCGAT. External right primer: TGTCCATTCGCAATTTTTGA. Internal left primer: ATATTTGCGACCGGCATTTA. Internal right primer: AAGCCTTGCCTATTTCCGAT. Internal WT amplicon: 2226 bp. Deletion size: 2034 bp. Deletion left flank: CGATATCGGCATGCTCGGCATCGCGTGGAG. Deletion right flank: TGAAAAAAAAAACAGAGAACTGTAAATTTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F59E11.11. External left primer: CGGAATATCCAAAAGGCTGA. External right primer: GGAAAAATCATTCAAGGCGA. Internal left primer: CGAAACCACAAATTGCTGAA. Internal right primer: CCATATGCATTGCGACTGAG. Internal WT amplicon: 2168 bp. Deletion size: 672 bp. Deletion left flank: CTTTTTTTCGAAACAAAATTAGATGAGGAA. Deletion right flank: AGAATAATGAACAAAACACAAAATTCTACA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

K12D12.1. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok1930 homozygotes (sterile Unc with withered tail, often grotty). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: TCCAATCAAAGGATTCGAGG. External right primer: ATGTCCTGGCCTTCCTTTTT. Internal left primer: GAACCCCTCAAGATCGCATA. Internal right primer: GGCTCCTTTGGCTCTTTCTT. Internal WT amplicon: 3358 bp. Deletion size: 1788 bp. Deletion left flank: TAGTGACGCTGGAGAAAGTTTTTATCCAGT. Deletion right flank: AGCTCCATGGTACAAGAACTTCCGCGGAAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T07C3.6. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP gk666 homozygotes (sterile). Viable fertile non-GFP progeny are recombinants and not homozygotes. Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TCTGCAGCGACCACTATGAC. External right primer: CAGAATCGATAGCCGAGAGG. Internal left primer: AATTTAATCGGCGGGTCTTC. Internal right primer: TTTGGCAATGAGGTGAGATG. Internal WT amplicon: 2334 bp. Deletion size: 892 bp. Deletion left flank: AGCGTTGTTGGACTCTGAATAGTTGGAGAT. Deletion right flank: GGAGGAGCGGGAAAACTATTCTAACTTAAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F47B7.5. Superficially wild type. External left primer: TCCGGAGCCATTGTAATCTC. External right primer: TTCAGGCATGCAAGTTATGC. Internal left primer: ATCAAACCGAAATGGGACAG. Internal right primer: CGAAGATGACACGATGGATG. Internal WT amplicon: 2546 bp. Deletion size: 1375 bp. Deletion left flank: AGCCTGACACCACGTATGTAGTTGGAATAA. Deletion right flank: TTGCGAGTGTTGTCATTATCGTTATCTTAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C08C3.3. External left primer: TACTGGTTGCGAGATTGCTG. External right primer: TTCATGCTCCTCCCAATTTC. Internal left primer: GTTCCTGTCTTCAAGGCGAC. Internal right primer: ATTCACACGTTGTTCGCATC. Internal WT amplicon: 2178 bp. Deletion size: 920 bp. Deletion left flank: AAAAACCTGTGAGAAATTTACAACAATTGA. Deletion right flank: TGCTCATTTGCCGACGGATTGAGTTGAGGG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F33D11.11. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP tm1411 homozygotes. Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: ACTCCGAGATAATACGGCGA. External right primer: ACGCTTGCCTCTAGGCACTA. Internal left primer: TTGGGGGAACGGGGAACCAT. Internal right primer: TAGGCACTAAGCACTGGCCA. Internal WT amplicon: 1799 bp. Deletion size: 657 bp. Deletion left flank: CCTCGTTCCTAACCGCAAAGGTTTTTGTAT. Deletion right flank: TGTTTTTTTTCTATTGGTATTTACGTACAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T20B3.3. Apparent homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP gk673 homozygotes (sterile adult, no eggs). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GAAGACGATCAGGAATGGGA. External right primer: AAAGCGGAAAGTGGGAAAGT. Internal left primer: GCCAAGAACCAAACTTCCAA. Internal right primer: CGATTTCCACGTACTGAGCA. Internal WT amplicon: 2225 bp. Deletion size: 958 bp. Deletion left flank: TAAGAATCTGACTTTCATTTCGGCTTGCAA. Deletion right flank: GCCCGTTTTGGCAATGATAATTGCTTTTCC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

K02B12. External left primer: GAGACAGACGAATGCAACGA. External right primer: GTGCCTTCTTTTTCCAACCA. Internal left primer: ACAGAAGAAAGGGCGGAAAT. Internal right primer: CAACTTCCAACTGCTTTGGG. Internal WT amplicon: 2295 bp. Deletion size: 508 bp. Deletion left flank: AGCGGTCTTTCTGCGTCTCGTCTAGCCACC. Deletion right flank: GTTACGTATTGACAACCTGGTGAAAAATCT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

K10D3.3. External left primer: GTCAACTGATATGAGCGGCA. External right primer: CGCGTAATCTTTTTCTTCGC. Internal left primer: GAACATGGCCCTGAAATGAT. Internal right primer: GGCGCTATTCAGCTTTCAAT. Internal WT amplicon: 2230 bp. Deletion size: 1887 bp. Deletion left flank: TGACTGATAATTTTTTAAAAACCCGAATAA. Deletion right flank: GAGAAATCGTTGACGGACAGGGAACTAGTC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

K09B11.2. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok1967 homozygotes (late larval arrest or sterile adult). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GAAGCAACTAACGGCTTTGC. External right primer: TTGCTCGATTCACACGAAAC. Internal left primer: TGGAGGAATTGTTGCAGTGA. Internal right primer: CCGGAAGGTTGTAGTCGTTG. Internal WT amplicon: 4083 bp. Deletion size: 1709. Deletion left flank: TTAGCTGGAGCGAATAACGATCGGAAAGTT. Deletion right flank: AAATATAACATTTTACAGTTTTCGTTTCAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

K11C4.4. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok1969 homozygotes (early larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TCGTTTTGATCCACTCGTGA. External right primer: CGCTACACCACATCATCACC. Internal left primer: TTTCATTCTTCATGGAGCCC. Internal right primer: CTCTCCAAAGTTGACTCCGC. Internal WT amplicon: 2148 bp. Deletion size: 1529 bp. Deletion left flank: CTCCCACATTTCCTCGCTCATCACATACAT. Deletion right flank: TGTAAGATCAAAACGCTGCTAGCAAACTCT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T07C5. External left primer: AAACCACTCACCAGGATTGC. External right primer: TATATTGCTCTGCGCGAATG. Internal left primer: TGTATCCGGCTGCATATTGA. Internal right primer: CCTTCACGATTTGTCGCTTT. Internal WT amplicon: 2177 bp. Deletion size: 560 bp. Deletion left flank: CAGATTTGAAACGTTAAACACTACAATCCA. Deletion right flank: TTTCAAAATCACAATTCCAAAATCATTTTG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C02H7.1. External left primer: GTGGTCTCCATGACAACGTG. External right primer: CTTTTTCAGTTTTGGAGGCG. Internal left primer: TCTTGCGTGTATTACCGCTG. Internal right primer: CTACCACCTCCAGCACCAGT. Internal WT amplicon: 1961 bp. Deletion size: 932 bp. Deletion left flank: GGTCAGCGCATAAATTTTCGCTAAATTTTC. Deletion right flank: CAAAAAGAGCAAAAAAGACCCGAGTGAACG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F31A9. External left primer: AGTTCCAATCCCTGCAACAC. External right primer: AGGTCCGGTACCTGTGACTG. Internal left primer: AGAACTTTGAGCGGCCATAA. Internal right primer: TCCTGTTCACGGAAACACAG. Internal WT amplicon: 1716 bp. Deletion size: 525 bp. Deletion left flank: TTAGGTTCAAAAAACAAACTCTCAAATTTC. Deletion right flank: AAAGATGTCTGGCTTCTCGTTTTTCATCAC. Insertion Sequence: ATTAAAGAGACATCATA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y40H7A.10. Superficially wild type. External left primer: CAACGGCAGTTCCATTTTCT. External right primer: TGAAAATTTCGGACAGGAGG. Internal left primer: TGAAGCGAACAACAAATTGC. Internal right primer: GGGCGCTATAGAAGTTGCAC. Internal WT amplicon: 2703 bp. Deletion size: 1128 bp. Deletion left flank: ACTGGGAAAAAACTTTGCATTTTTAAAAAC. Deletion right flank: AAATAATTTATGCTTGAGAACTGTTCGTAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F07A11.3. Superficially wild type. External left primer: TCACGTGAAACCCACAGAAA. External right primer: CTTCCAACTCCTTCGACGAC. Internal left primer: TGTCTGTGAAAGATCGACCG. Internal right primer: CGATATTCCTCAAGGGCAAA. Internal WT amplicon: 2771 bp. Deletion size: 1291 bp. Deletion left flank: AGCCCAAGTTTCAGAGCAATAGTGATCATG. Deletion right flank: TGTCATCTGGTAGTACTTTGCGCGTCGAGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C50H2.6. External left primer: ATCTCCCCGGTTTCCATATC. External right primer: ATATGACTAGCACGGCAGGG. Internal left primer: TTTCTTGCCTCCCTCTTGAA. Internal right primer: AGTCACTCACGGGCAAAGAT. Internal WT amplicon: 2224 bp. Deletion size: 341 bp. Deletion left flank: AGACACGACTCAATGAAGATGAGCAGCAAA. Deletion right flank: TCGGCTCGTACGAGGCTGAATAACAGAAGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T01G6.8. External left primer: TTCGGATACTTTTCGGTTGC. External right primer: TTCCATTTTTACGGTCCTCG. Internal left primer: GATATGAGGTCCCGATCGAA. Internal right primer: TGAGGCAGATTGGTGTTCTG. Internal WT amplicon: 2444 bp. Deletion size: 834 bp. Deletion left flank: CCCGCAAGTTTTATCTCAAAATTTTGAATT. Deletion right flank: CGAAAAAATCGTAATAAAACGATTTTTTGC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

H14A12.2. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP+ (heterozygotes), arrested hT2 aneuploids, and non-GFP ok1998 homozygotes (sterile adult). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP+ and check for correct segregation of progeny to maintain. External left primer: ACTTGTGCGGGAGAAGAGAA. External right primer: CGAATTAAGCTTTCAAGGCG. Internal left primer: GAACCATGCCGAGTTTGATT. Internal right primer: TGAACATTTGGGGACATTGA. Internal WT amplicon: 2152 bp. Deletion size: 1351 bp. Deletion left flank: ACTTTCGGAGAGCTCGAGGTTCCAGCCGAC. Deletion right flank: TGCTCACAAGAACGGCACCACCCTTGTCCA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

M106.5. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes) and non-GFP ok1929 homozygotes (early larval arrest). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: TTTGTTCTTTTTGCACGCTG. External right primer: AGGGAACTGATGTTCCGATG. Internal left primer: CGGGAGCCAATTTACAGAAA. Internal right primer: GAACGAAAATGGTCCAGGAA. Internal WT amplicon: 2129 bp. Deletion size: 1084 bp. Deletion left flank: AAAACAAAAATTTGAAGAACTCTGGCGAAA. Deletion right flank: CTGCAGACAAACAAAAGCTCCAGCGGTGTG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F16B4.12. External left primer: CATACGGCAAGTTCAGCAAA. External right primer: CTACCAACCTGGTCATGGCT. Internal left primer: TCGGGATTTGACAAGTTCGT. Internal right primer: GCCGACTGTTGTCAGGATCT. Internal WT amplicon: 1781 bp. Deletion size: 349 bp. Deletion left flank: TTTGCCGCTGCACACATGTATGTTTGAAAA. Deletion right flank: AAAATCCTCTGATCGGTTTCGTCTAGCGTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F34D6.2. External left primer: TCCTGTCAACCCTCAGCTCT. External right primer: ATAATGCATTGCAGAGCACG. Internal left primer: ATGGTTCACACGGTTTCTGG. Internal right primer: ACACAACGAGAGCCCATTTC. Internal WT amplicon: 2355 bp. Deletion size: 1929 bp. Deletion left flank: TTTGCACCCCTTTGCTCAACTTTGACAGCT. Deletion right flank: TTTCAAAAAATCTTAAAATATTACCATATC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F54F7.1. External left primer: GTCAGCCGAATCAAAAGCTC. External right primer: TTTCCTTCCTCTCCCGATTT. Internal left primer: CCACTCTGTTGCCAATTTGA. Internal right primer: GGACGAAGAGCGTCCAAATA. Internal WT amplicon: 2248 bp. Deletion size: 1772 bp. Deletion left flank: AGTTCATTTGTTTGTTTATTTGTTTCGTTT. Deletion right flank: TACATTAAAATTGAAAATGGGAAACTAAGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

K11G9.4. External left primer: GGACATTTGTGTTGTGCCAG. External right primer: ACAATTTGGGCGATTGAAAG. Internal left primer: ACAGCCGGCAGATACAGTCT. Internal right primer: GGTGGAATAAACGTCCGCTA. Internal WT amplicon: 2234 bp. Deletion size: 1144 bp. Deletion left flank: GCCGATAGCTTTACTCACCTTTATGAACAT. Deletion right flank: TTTTATTGGCATTTGAAAAGTGGCAATTAC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y58G8A.2. External left primer: GGGCCAGTTGGTCAGAGATA. External right primer: GGGAAGTGATTCGTTCTCCA. Internal left primer: TGCACTCAAGATCAAACGGA. Internal right primer: CTAGACTGGGCGGCATTTAG. Internal WT amplicon: 2306 bp. Deletion size: 1295 bp. Deletion left flank: TTTGGAGCTTTTTTGAACTTTCTTAAAAGT. Deletion right flank: GGAAAGTTTGTAACAGATACATCTGTGCTC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

K12D12.2. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok1999 homozygotes (early- to mid-larval arrest). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: TCTTGCCAGTGTCAATCAGC. External right primer: TCGCTCTCCACTTCTCCAGT. Internal left primer: CCCCAGAACCACAAGACACT. Internal right primer: TCGATGCTTGATTTGCTGAC. Internal WT amplicon: 3383 bp. Deletion size: 1321 bp. Deletion left flank: GTAACCAACAATCATACGACGAACAGCGAA. Deletion right flank: ATTCGATATATTTGAGGCCTGAAACTCACG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F13D12.7. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok1875 homozygotes (early larval arrest). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: TTGATGTGGGGGTTTTAGGA. External right primer: ATCGCGTCGCTCACTAGAAT. Internal left primer: ATCGGGGAGAGAAAGAGAGC. Internal right primer: GGGGCACTATTGCATCATCT. Internal WT amplicon: 2980 bp. Deletion size: 1978 bp. Deletion left flank: GTAGAATACGATCGGGGAGAGAAAGAGAGC. Deletion right flank: ACGAGACACCCGCACGTTTCCCTCGCGTGT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y92C3B.1, F58B6.3. Apparent homozygous lethal deletion chromosome balanced by dpy-1-marked recombination suppressor. Heterozygotes are WT, and segregate WT, Dpy (sC1 homozygotes), and ok1890 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: AAAACCCCTCACCTCGACTT. External right primer: AAAAATTGGAAAAATCCGGG. Internal left primer: CGAAGGGAAAATGCAGGATA. Internal right primer: TAAAAATCGGCAGAAATCGG. Internal WT amplicon: 2138 bp. Deletion size: 898 bp. Deletion left flank: AGGATAATTTTTTTTTTGTTGGGAAATTTA. Deletion right flank: TACGGGCTTCGCAGAGCGATTTATCGATTG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F41D9.5. Apparent homozygous lethal deletion chromosome balanced by lon-2-marked translocation. Heterozygotes are WT, and segregate WT, Lon-2 males, arrested szT1 aneuploids, and ok1953 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: CCTCGTAAGGGTAATTGGCA. External right primer: TCCAAGAAGGAGTGGTCCAG. Internal left primer: TTCATCAACAGCAGTTTGGC. Internal right primer: CAACGTGCATATCCCAACAG. Internal WT amplicon: 3086 bp. Deletion size: 2464 bp. Deletion left flank: GTTTCTGACATGACCTCTTCAGAATTTTCA. Deletion right flank: GAGGAAATCTGTTGATTAAATAATGAGTCA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T19H12.8. External left primer: CCTGGATTCGATTTTCGGTA. External right primer: GGCATCAGAAATGCTCCAAT. Internal left primer: AATAATGGCATCGGTTCTGG. Internal right primer: TCCAACCAAATGAGAGTCCC. Internal WT amplicon: 2272 bp. Deletion size: 672 bp. Deletion left flank: CCATTGGGGAAATTGCTTCAAACCCCGCAT. Deletion right flank: TTGTATTTTTTTCTCAAAGGTCTATAATTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F32H5.1. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok2017 homozygotes (embryonic or early larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GCCTTTGACAGAGACTTCGG. External right primer: GAGTTCGCGGAAATTTATGG. Internal left primer: CTAGACGGCGATACCTGGAA. Internal right primer: TTTCCAACATCCCTGGAGAG. Internal WT amplicon: 2266 bp. Deletion size: 1489 bp. Deletion left flank: ATCGTAAGAAATCATACCATTCTCTCCAAA. Deletion right flank: GTTTCCGCTTTCCATAGTTTCTGTTTTTTG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

H01G02.2. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP gk687 homozygotes (embryonic or early larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GTGCATGGAAAGGCAAAAAT. External right primer: TCGCTACAGGGGAGAAAAGA. Internal left primer: GTTCGGTCTTTGGTCGTGTT. Internal right primer: CGGAAACCATTTGAGGCTAC. Internal WT amplicon: 1834 bp. Deletion size: 449 bp. Deletion left flank: TGAAGCTATTCAGAACAATTCAATTTTTAT. Deletion right flank: GAAGAAGATTAAAGTGTGAATGTGTACATT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C02B4.1. Apparent homozygous lethal deletion chromosome balanced by lon-2-marked translocation. Heterozygotes are WT, and segregate WT, Lon-2 males, arrested szT1 aneuploids, and ok1965 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: ATACGACGACCTCAGTTGCC. External right primer: GCACAACTTTTGTCGGGTTT. Internal left primer: GTGTGACCCGTTATTCGCTT. Internal right primer: GCTCAGGACAACTTGCTTCC. Internal WT amplicon: 3370 bp. Deletion size: 1659 bp. Deletion left flank: TGATGCTTCCCCAGGCCTTATATCTACAAA. Deletion right flank: ATGGGGCGATTGGCTGCCGTGCTCTGTATC. Insertion Sequence: A. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T23G5.3. Superficially wild type. External left primer: TCTTGTGCAAGTTCGAAACG. External right primer: AATTGAAAAGGGTGTGCGTC. Internal left primer: GTACATCTTCCTTTCGCCCA. Internal right primer: TAACCTTCCCCAAGATTCCC. Internal WT amplicon: 2170 bp. Deletion size: 683 bp. Deletion left flank: TTAATTTTATAATTCTATAGATATTCTACT. Deletion right flank: TCAAATTTTCCCAATCTACCGTAACCCCCA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y58G8A. External left primer: GGGCCAGTTGGTCAGAGATA. External right primer: GGGAAGTGATTCGTTCTCCA. Internal left primer: TGCACTCAAGATCAAACGGA. Internal right primer: CTAGACTGGGCGGCATTTAG. Internal WT amplicon: 2306 bp. Deletion size: 125 bp. Deletion left flank: ATTCAACAAGGGAAATGGGGGCTGGGTAAA. Deletion right flank: CTTTGAAGAGACACAGGTGTGAGTTTGCGG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T07C5.4. External left primer: TTGCTCAAAAGAAGCGGAAT. External right primer: TGGTTATGCGTCCAGTGAGA. Internal left primer: ACAAGCCTAATCTGCATGGG. Internal right primer: TGTGACGTCTGCAACAATCC. Internal WT amplicon: 2331 bp. Deletion size: 1279 bp. Deletion left flank: GATAAAATCATACTAAGCTGTCTGAAGACA. Deletion right flank: AAACAATCAACGAAAAATTAGAGTTCGATA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C07G2.2. External left primer: CAAGAAGGGACGGAAATTCA. External right primer: AATATTTGCAGGTGGTTCGC. Internal left primer: GCTGTGGAGCTCGAAGAGTT. Internal right primer: CCACTGTTTCTCCACCCATT. Internal WT amplicon: 1805 bp. Deletion size: 1197 bp. Deletion left flank: ATTCCTCTAGTATTCCATAAATCTTGACAT. Deletion right flank: AGAAAAACAAACAAAAAGCTTACCTCTGTA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C14B9.6. External left primer: CCCTCTCATTGTTCGTTCGT. External right primer: TTTTCGGGCAACAACTTTTC. Internal left primer: ATTTCATTGCGTGCATGTGT. Internal right primer: TAACTGTCAGCGTCTCGTCG. Internal WT amplicon: 1595 bp. Deletion size: 1018 bp. Deletion left flank: CGCCAATGACAACGAAGAAAATAAACTGAA. Deletion right flank: ATGAAAATCAAGGAGACGTCAGAGCAGACA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T01G6.8. External left primer: TTCGGATACTTTTCGGTTGC. External right primer: TTCCATTTTTACGGTCCTCG. Internal left primer: GATATGAGGTCCCGATCGAA. Internal right primer: TGAGGCAGATTGGTGTTCTG. Internal WT amplicon: 2444 bp. Deletion size: 1218 bp. Deletion left flank: TTTGAAGCTTCCGCAAAAATTTACATTCCC. Deletion right flank: AAAAAAAATACCGGAAAATAGGCTCCGCCC. Insertion Sequence: AAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

ZK520.3. External left primer: GAGGTCGCTCCACTCTCAAC. External right primer: CAGCAGACGCACTCACATTT. Internal left primer: CGGCAATCGCTAGTACATCA. Internal right primer: TCGATGTCGGCTGTGTATTC. Internal WT amplicon: 1671 bp. Deletion size: 202 bp. Deletion left flank: TGCCCATTTGGTCTCCATCGATGAATAATC. Deletion right flank: AAAAAATGAAGTACAAATCATTGAGCTACC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T23G7.1. Apparent homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP gk685 homozygotes (sterile, with few eggs that don't hatch). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: CGATTTCCATCAGCAGTGAA. External right primer: ATACCGGCAGCAGCTAGAAA. Internal left primer: TTTGACAACAATCCAATCGC. Internal right primer: AGCTTGTCGGCTCAACGTAT. Internal WT amplicon: 2352 bp. Deletion size: 871 bp. Deletion left flank: ACAAACCAACCGGACTCAGACATTTTTCCA. Deletion right flank: TGGAAACCACAATTTTCAGACCGTAAAAAG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F16B4.12. Superficially wild type. External left primer: CATACGGCAAGTTCAGCAAA. External right primer: CTACCAACCTGGTCATGGCT. Internal left primer: TCGGGATTTGACAAGTTCGT. Internal right primer: GCCGACTGTTGTCAGGATCT. Internal WT amplicon: 1781 bp. Deletion size: 1010 bp. Deletion left flank: TCACAAATCACCTCATCGTAAAACATTTCA. Deletion right flank: CGAGTGCTAAAAGCGGGCTCCGCGCAGACT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C34B4.2. External left primer: TAGGGCGACAGGTTCAAAAC. External right primer: AACTGATGGACCAGGCAGAC. Internal left primer: TGTGAAGTGATGCGGTGTTT. Internal right primer: GTATGGAACGGCATGGAACT. Internal WT amplicon: 2195 bp. Deletion size: 1165 bp. Deletion left flank: TCAACTGATAAGGACACTGTCCTCCGTATT. Deletion right flank: TGATCTTTTCACTCTTTCCCTCTCCACCTG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

H12C20.3. External left primer: CGGTTCTAATCCTCCGTCAA. External right primer: AGCGCACCTGTAAATTGCTT. Internal left primer: TGCCTTGTTTGCCAAGATTT. Internal right primer: CTCCAACCCGTCCTTCTGTA. Internal WT amplicon: 1761 bp. Deletion size: 1301 bp. Deletion left flank: TTATATCATGTTTAGCCCACAAATATTCTA. Deletion right flank: TTTCCGGATGGAACATATTATGATAGAACT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F26C11.2. Unc. External left primer: TTCATGGTGAGAACGAGCAG. External right primer: GGCATATGTACGAGGCAGGT. Internal left primer: CGCAAGGTGAAATGAGTGAA. Internal right primer: GCCGACACGCCTACTTTCTA. Internal WT amplicon: 2274 bp. Deletion size: 307 bp. Deletion left flank: TGCAAAGTATTTCACTACAGTTTTACTGTA. Deletion right flank: GCTTAATCCTGCTAGACTTCTACCACAAAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T01G9.5. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2000 homozygotes (sterile, lays eggs that don't hatch). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TAATTGTTTGTCGCGGATGA. External right primer: GATGAAGGTGGCCTTGAAAA. Internal left primer: TGTTTCCAACAAGTGAGCCA. Internal right primer: CAAAAACCAAAGCTAGGCCA. Internal WT amplicon: 2180 bp. Deletion size: 1378 bp. Deletion left flank: ACAAAGAAAGGAGTTGGAGCAGCAGGTCCA. Deletion right flank: CAAAGAATGGTGTGACTCTTTTGGTGCCAT. Insertion Sequence: TGTAAATCAACTATTTATTGTGATCTCCTTTTAGTTTAAAATATTGTGGCCTAGCTTTG GGTTTTTGAAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y37D8A.2. External left primer: TATTGGCCTTGAGAACACCC. External right primer: CTCTTCGTCAGTTTTTCGGC. Internal left primer: TTGAAAGCGCGAAACAATTT. Internal right primer: CTTCAGGCTTCTGGCAAACT. Internal WT amplicon: 1789 bp. Deletion size: 306 bp. Deletion left flank: ATGATTTTTTGAAAATTAAAAAAAAACCAG. Deletion right flank: TTTTGCCTTTTTCTTCAAAATCCAAGCAAA. Insertion Sequence: CC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807