| RG3100 |
C. elegans |
icmt-1(ve600[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) I. Show Description
Homozygous viable. Deletion of 1396 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: gattattataaaaagcgtgaaaacgtgaaa ; Right flanking sequence: tggaaaaacaaatagttacgcattatttcc. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| NK2949 |
C. elegans |
qySi205 I. Show Description
qySi205 [lin-29p::icmt-1::mscarlet] I. MosSCI single copy insertion. Anchor cell specific expression of prenylation enzyme icmt-1. Superficially wild-type. Reference: Park K, et al. J Cell Biol. 2024 Oct 7;223(10):e202402035. PMID: 39007804.
|
|
| NK2966 |
C. elegans |
qySi205 I; unc-6(ev400) X. Show Description
qySi205 [lin-29p::icmt-1::mScarlet] I. unc-6 mutant expressing anchor cell specific prenylation enzyme icmt-1. Reference: Park K, et al. J Cell Biol. 2024 Oct 7;223(10):e202402035. PMID: 39007804.
|
|
| NK2990 |
C. elegans |
qySi205; qyIs562. Show Description
qySi205 [lin-29p::icmt-1::mscarlet] I. qyIs562 [zmp-1p::zmp-1sp::sfGFP::KDEL]. MosSCI single copy insertion for anchor cell specific expression of prenylation enzyme icmt-1 and anchor cell specific expression of KDEL ER lumen marker. Superficially wild-type. Reference: Park K, et al. J Cell Biol. 2024 Oct 7;223(10):e202402035. PMID: 39007804.
|
|
| NK3065 |
C. elegans |
qySi205 I; sec-16A.1(qy234[mNG::sec16A.1]) III. Show Description
qySi205 [lin-29p::icmt-1::mscarlet] I. MosSCI single copy insertion for anchor cell specific expression of prenylation enzyme icmt-1 and sec-16A.1 locus endogenously tagged with mNG at the N-terminus. Superficially wild-type. Reference: Park K, et al. J Cell Biol. 2024 Oct 7;223(10):e202402035. PMID: 39007804.
|
|