More Fields
Strain Species Genotype
DQM311 C. elegans hlh-2(bmd90[LoxP::GFP::hlh-2]) I. Show Description
GFP reporter inserted into N-terminus of endogenous hlh-2 locus. Reference: Medwig-Kinney TN, et al. Development. 2020 Jan 2;147(1).
GS8949 C. elegans hlh-2(ar623[gfp::hlh-2]) I. Show Description
GFP tag inserted into endogenous hlh-2 locus produces a fully-functional GFP-tagged form of HLH-2. Reference: Attner et al., 2019, Current Biology 29, 1-7.
JK4099 C. elegans hlh-2(tm1768) I. Show Description
Temperature sensitive sterile. Partially sterile at 20 C; completely sterile at 25 C. Maintain at <20 C. Do not distribute this strain; other labs should request it directly from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
EM496 C. elegans hlh-2(bx108) I; him-5(e1490) V; lin-32(e1926) X. Show Description
Males are rayless. hlh-2(bx108) strongly and semi-dominantly enhances the ray-loss phenotype of lin-32(e1926).
EM598 C. elegans hlh-2(bx115) unc-13(e51) I; him-5(e1490) V. Show Description
Paralyzed Unc. Throws males. hlh-2(bx115) has no phenotype in this background.
MT19085 C. elegans hlh-2(n5287) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP n5287 homozygotes (embryonic lethal). Homozygous hT2 [bli-4 let-? qIs48] inviable. Pick wild-type GFP and check for correct segregation of progeny to maintain. n5287 is a 2,694 bp deletion (flanking seq 5' - TGCAACTGCCGCCATTGCTC 3' - AAAACTCTCTAGCATATTGT) and 25 bp insertion (TCTGCCATCATTGCTGCCATTGCTC). Reference: Nakano S, Ellis RE, Horvitz HR. Development. 2010 Dec;137(23):4017-27.
MT19635 C. elegans lin-15B&lin-15A(n765) X; nIs407. Show Description
nIs407 [hlh-2::GFP + lin-15(+)]. Reference: Nakano S, Ellis RE, Horvitz HR. Development. 2010 Dec;137(23):4017-27.
NK885 C. elegans unc-119(ed4) III; qyIs174. Show Description
qyIs174 [hlh-2p::GFP::hlh-2 + unc-119(+)]. Translational fusion protein displaying cytoplasmic and nuclear localization; contains 8 kb upstream, N-terminal GFP fusion, full open reading frame and 3'UTR. Reference: Schindler AJ, Sherwood DR. Dev Biol. 2011 Sep 15;357(2):380-91.
OH10596 C. elegans otEx4720. Show Description
otEx4720 [YFP::hlh-2(+)(fosmid; N-terminal fusion)+ rol-6(su1006)]. Rollers. Maintain at 15-20C by picking rollers. Fosmid was recombineered in Greenwald Lab.
OH12412 C.elegans otIs502. Show Description
otIs502 [hlh-2(fosmid)::YFP + myo-3p::mCherry]. Broad embryonic expression; later in development transgene is expressed in DTCs, vulva, and some gland cells in pharynx. Reference: Masoudi N, et al. PLoS Biol. 2018 Apr 19;16(4):e2004979.
OP712 C. elegans unc-119(tm4063) III; wgIs712. Show Description
wgIs712 [hlh-2::TY1::EGFP::3xFLAG + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov M, et al. Nat Methods (2006) 10:839-44. Zhong, M, et al. PLoS Genet (2010) 6(2):e1000848. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org).
PD4655 C. elegans dpy-20(e1282) IV; ccIs4655. Show Description
ccIs4655 [pes-10::GFP + dpy-20(+) ]. GFP expression in lineages with active HLH-8/HLH-2 (e.g., sex muscle, head mesodermal cell). Transgene contains pes-10::GFP reporter driven by 8 copies of an HLH-8/HLH-2 response site from the ceh-24 promoter.
RW11575 C. elegans unc-119(tm4063) III; stIs11575. Show Description
stIs11575 [hlh-2::H1-wCherry + unc-119(+)].
UL1546 C. elegans unc-119(ed3) III; leEx1546. Show Description
leEx1546 [hlh-2::GFP + unc-119(+)]. Superficially wildtype. Grove C. A., De Masi F., et al (2009) Cell 138(2); 314-327.
VL507 C. elegans unc-119(ed3) III; wwIs20. Show Description
wwIs20 [hlh-2::mCherry::his-11 + unc-119(+)]. Superficially wildtype. Grove C. A., De Masi F., et al (2009) Cell 138(2); 314-327.
VL529 C. elegans unc-119(ed3) III; wwIs20; leEx1432. Show Description
wwIs20 [hlh-2::mCherry::his-11 + unc-119(+)]. leEx1432 [hlh-10::GFP + unc-119(+)]. Superficially wildtype. Grove C. A., De Masi F., et al (2009) Cell 138(2); 314-327.
VL530 C. elegans unc-119(ed3) III; wwIs20; leEx1583. Show Description
wwIs20 [hlh-2::mCherry::his-11 + unc-119(+)]. leEx1583 [hlh-4::GFP + unc-119(+)]. Superficially wildtype. Grove C. A., De Masi F., et al (2009) Cell 138(2); 314-327.
VL531 C. elegans unc-119(ed3) III; wwIs20; wwEx37. Show Description
wwIs20 [hlh-2::mCherry::his-11 + unc-119(+)]. wwEx37 [ngn-1::GFP + unc-119(+)]. Superficially wildtype. Grove C. A., De Masi F., et al (2009) Cell 138(2); 314-327.
VL536 C. elegans unc-119(ed3) III; wwIs20; leEx1566. Show Description
wwIs20 [hlh-2::mCherry::his-11 + unc-119(+)]. leEx1566 [lin-32::GFP + unc-119(+)]. Superficially wildtype. Grove C. A., De Masi F., et al (2009) Cell 138(2); 314-327.
VL551 C. elegans unc-119(ed3) III; wwIs20; wwEx40. Show Description
wwIs20 [hlh-2::mCherry::his-11 + unc-119(+)]. wwEx40 [cnd-1::GFP + unc-119(+)]. Superficially wildtype. Grove C. A., De Masi F., et al (2009) Cell 138(2); 314-327.
VL559 C. elegans unc-119(ed3) III; wwIs20; wwEx36. Show Description
wwIs20 [hlh-2::mCherry::his-11 + unc-119(+)]. wwEx36 [hlh-19::GFP + unc-119(+)]. Superficially wildtype. Grove C. A., De Masi F., et al (2009) Cell 138(2); 314-327.
VL562 C. elegans unc-119(ed3) III; wwIs20; wwIs19. Show Description
wwIs20 [hlh-2::mCherry::his-11 + unc-119(+)]. wwIs19 [hlh-6::GFP + unc-119(+)]. Superficially wildtype. Grove C. A., De Masi F., et al (2009) Cell 138(2); 314-327.
VL565 C. elegans unc-119(ed3) III; wwIs20; leEx1601. Show Description
wwIs20 [hlh-2::mCherry::his-11 + unc-119(+)]. leEx1601 [hlh-8::GFP + unc-119(+)]. Superficially wildtype. Grove C. A., De Masi F., et al (2009) Cell 138(2); 314-327.
VL566 C. elegans unc-119(ed3) III; wwIs20; leEx1546. Show Description
wwIs20 [hlh-2::mCherry::his-11 + unc-119(+)]. leEx1546 [hlh-2::GFP + unc-119(+)]. Superficially wildtype. Grove C. A., De Masi F., et al (2009) Cell 138(2); 314-327.
VL585 C. elegans unc-119(ed3) III; wwIs20; leEx1556. Show Description
wwIs20 [hlh-2::mCherry::his-11 + unc-119(+)]. leEx1556 [hlh-12::GFP + unc-119(+)]. Superficially wildtype. Grove C. A., De Masi F., et al (2009) Cell 138(2); 314-327.
VL586 C. elegans unc-119(ed3) III; wwIs20; wwEx42. Show Description
wwIs20 [hlh-2::mCherry::his-11 + unc-119(+)]. wwEx42 [hlh-15::GFP + unc-119(+)]. Superficially wildtype. Grove C. A., De Masi F., et al (2009) Cell 138(2); 314-327.
RB1337 C. elegans hlh-26(ok1453) II. Show Description
C17C3.8 Homozygous. Outer Left Sequence: ccagttccgcctgtaacatt. Outer Right Sequence: ttgccacgactggatattga. Inner Left Sequence: actcacctctgcaactgcct. Inner Right Sequence: agtgtcacacgctgagatgg. Inner Primer PCR Length: 2179. Deletion Size: 983 bp. Additional information from Casonya Johnson 3/2005: the deletion is 983 bases, from base 2254 to 3237 on the cosmid C17C3. The gene C17C3.8 is on the opposite strand, and its coding region is from bases 3237 to 3616. The deletion occurs within the second exon of the gene, so that the first 105 amino acids of the protein are still made. This region contains one of the two HLH domains produced by this protein but eliminates the second one. The first stop codon would allow another 19 amino acids to be added to the peptide. I have pasted the sequence below (the red, underlined sequences are the new nucleotides). MSSSPTSSSS GSPSSHGHRS ETEKQRRDDT NDLLNEFKKI VQKSESEKLS KEEVLFRIVK LLSGIQLHHE SFSTSPGPIR SIKKIKSDRE QVRRNKRVAA YRELR tiknkhlehvfnffelki stop Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RW12174 C. elegans hlh-26(st12174[hlh-26::GFP + loxP + unc-119(+) + loxP] II; unc-119(tm4063) III. Show Description
hlh-26(st12174[hlh-26::GFP + loxP + unc-119(+) + loxP] II.
UL1444 C. elegans unc-119(ed3) III; leEx1444. Show Description
leEx1444 [hlh-29::GFP + unc-119(+)]. Superficially wildtype. Grove C. A., De Masi F., et al (2009) Cell 138(2); 314-327.
VC1220 C. elegans hlh-25(ok1710) II. Show Description
C17C3.7. Superficially wild type. External left primer: TTTCCATCTCAGCGTGTGAC. External right primer: ACATCCTGTCCCAGCTTCAC. Internal left primer: AGCAAACCGGAGTTCTCAAA. Internal right primer: AGAATGGGACATCCCACAAA. Internal WT amplicon: 2113 bp. Deletion size: 1550 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC4436 C. elegans hlh-27(gk5511[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) II. Show Description
Homozygous viable. Deletion of 1407 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: GAAGAACTTGATAGACTAGTTACTAATATC. Right flanking sequence: ATTGGGTACTGCCTGGGAAATTCCGGCTGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VL13 C. elegans unc-119(ed3) III; wwEx43. Show Description
wwEx43 [hlh-27::GFP + unc-119(+)]. Superficially wildtype. Grove C. A., De Masi F., et al (2009) Cell 138(2); 314-327.