| CF4592 |
C. elegans |
muIs253 II; unc-119(ed3) III; his-3(mu496[his-3::sfGFP11]) V. Show Description
muIs253 [eft-3p::sfGFP1-10::unc-54 3'UTR + Cbr-unc-119(+)] II. Somatic expression of sfGFP1-10 (under the control of the eft-3 promoter and the unc-54 3'UTR). GFP11 tag inserted into endogenous his-3 locus via CRISPR/Cas9 insertion into parental strain CF4587. Reference: Goudeau J, et al. Genetics. 2021 Apr 15;217(4):iyab014. doi: 10.1093/genetics/iyab014. PMID: 33693628
|
|
| CF4594 |
C. elegans |
muIs252 II; unc-119(ed3) III; his-3(mu497[his-3::wrmScarlet11]) V. Show Description
muIs252 [eft-3p::wrmScarlet1-10::unc-54 3'UTR + Cbr-unc-119(+)] II. Homozygous viable. Endogenously-tagged his-3::wrmScarlet11 generated via CRISPR/Cas9 insertion into parental strain CF4582. Reference: Goudeau J, et al. Genetics. 2021 Apr 15;217(4):iyab014. doi: 10.1093/genetics/iyab014. PMID: 33693628
|
|
| CF4608 |
C. elegans |
muIs252 II; unc-119(ed3) III; his-3(mu500[his-3::wrmScarlet11(x3)]) V. Show Description
muIs252 [eft-3p::wrmScarlet1-10::unc-54 3'UTR + Cbr-unc-119(+)] II. Homozygous viable. Endogenously-tagged his-3::wrmScarlet11(x3) generated via CRISPR/Cas9 insertion of three wrmScarlet11 tags into the endogenous his-3 locus in parental strain CF4582. Reference: Goudeau J, et al. Genetics. 2021 Apr 15;217(4):iyab014. doi: 10.1093/genetics/iyab014. PMID: 33693628
|
|
| RG3221 |
C. elegans |
veDf2[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP] IV. Show Description
Homozygous viable. 2996 bp deletion removes his-31, his-32, his-33 and his-34, with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TCAGAGCATAGACGACGTCCATAGCAGTTA ; Right flanking sequence: CCTAATTGAGTTGTTCCAATAAAATTTTCA. sgRNA #1: CGAGCACGCCAAGAGAAAGA; sgRNA #2: TCTTTCAGAACAACATCTCA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3354 |
C. elegans |
veDf3 [LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP] V. Show Description
Homozygous viable. Deletion of 4002 bp removes his-8, his-7, his-6, his-5, and his-39, with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TTCGGTGATTTGCTTTCAGCAATTGAATGC ; Right flanking sequence: GCATTCAATTGCTGAAAGCAAATCACCGAA. his-8/his-39 sgRNA #1: ATTGAATGCTTACTTGCTAG; his-8/his-39 sgRNA #1: ATTGAATGCTTACTTGCTAG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VC2157 |
C. elegans |
his-37(gk1002) V. Show Description
C50F4.7. External left primer: GATCCAGAGCTTCTCGCAGT. External right primer: ACAATTCCAGGTGGACAAGC. Internal left primer: TCTTCACCGTCTTTCCGAAC. Internal right primer: ATGGTTGGTAGCCACTGCTT. Internal WT amplicon: 820 bp. Deletion size: 317 bp. Deletion left flank: TCGTTTTCTAACAACTTTTAATCATGTCTG. Deletion right flank: CGATGGACGTTGTCTATGCCTTGAAACGTC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|