More Fields
Strain Species Genotype
HZ112 C. elegans muIs16 II; sor-1(bp3)/qC1 [dpy-19(e1259) glp-1(q339)] III; him-5(e1490) V. Show Description
muIs16 [mab-5::GFP]. Larval lethal at L3/L4 stage. Ectopic expression of GFP in the arrested sor-1 mutant homozygotes (L3 stage).
MT5823 C. elegans lin-26(n156) unc-4(e120)/mnC1 [dpy-10(e128) unc-52(e444)] II; him-5(e1490) V. Show Description
Heterozygotes are WT.
AD294 C. elegans cylc-2(mon2[cylc-2::mNG::3xFLAG) I; him-5(e1490) V. Show Description
Endogenous cycl-2 locus tagged with mNeonGreen (mNG). Green fluorescence in sperm. Him. Reference: Krauchunas AR, et al. (2020). C. elegans CYLC-2 localizes to sperm. microPublication Biology. 10.17912/micropub.biology.000314.
CG1438 C. elegans egl-2(rg444) him-5(e1490) V. Show Description
rg444 is an endogenous genomic CRISPR/Cas9 knock in of YFP fused to the C-terminus of the EGL-2 K+ Channel in N2 background. Faint YFP fluorescent puncta can be detected on muscle membranes and neural cell bodies and processes at high power magnification in all stages. Him. Reference: Goncalves J, et al. iScience 2020 Mar 19;23(4):100990. PMID: 32240955
EG7477 C. elegans syIs46 II; unc-119(ed3) III; oxTi483 X. Show Description
syIs46 [hsp16p::GFP-LacI; dpy-30p::S65TGFP; dpy-20(+)], oxTi483 [256xLacO + Cbr-unc-119(+) + PuroR]. MiniMos plasmid (pCFJ797) with 256x LacO, Cbr-unc-119(+) and PuroR inserted into syIs46 II; unc-119(ed3) III strain derived from PS2958. May still contain ncl-1 (e1865) III, him-5(e1490)V or dpy-20(e1282ts) IV from PS2958. Puro resistance verified.
EG7478 C. elegans syIs46 II; unc-119(ed3) III; oxTi487 X. Show Description
syIs46 [hsp16p::GFP-LacI; dpy-30p::S65TGFP; dpy-20(+)], oxTi487 [256xLacO + Cbr-unc-119(+) + PuroR]. MiniMos plasmid (pCFJ797) with 256x LacO, Cbr-unc-119(+) and PuroR inserted into syIs46 II; unc-119(ed3) III strain derived from PS2958. May still contain ncl-1 (e1865) III, him-5(e1490)V or dpy-20(e1282ts) IV from PS2958. Puro resistance verified.
EG7522 C. elegans syIs46 II; oxTi467 unc-119(ed3) III. Show Description
syIs46 [hsp16p::GFP-LacI; dpy-30p::S65TGFP; dpy-20(+)], oxTi467 [256xLacO + Cbr-unc-119(+) + NeoR]. MiniMos plasmid (pCFJ796) with 256x LacO, Cbr-unc-119(+) and NeoR inserted into syIs46 II; unc-119(ed3) III strain derived from PS2958. May still contain ncl-1 (e1865) III, him-5(e1490)V or dpy-20(e1282ts) IV from PS2958. Neo resistance verified.
EG7523 C. elegans oxTi468 I; syIs46 II; unc-119(ed3) III. Show Description
syIs46 [hsp16p::GFP-LacI; dpy-30p::S65TGFP; dpy-20(+)], oxTi468 [256xLacO + Cbr-unc-119(+) + NeoR]. MiniMos plasmid (pCFJ796) with 256x LacO, Cbr-unc-119(+) and NeoR inserted into syIs46 II; unc-119(ed3) III strain derived from PS2958. May still contain ncl-1 (e1865) III, him-5(e1490)V or dpy-20(e1282ts) IV from PS2958. Neo resistance verified.
EG7524 C. elegans syIs46 II; unc-119(ed3) III; oxTi469 IV. Show Description
syIs46 [hsp16p::GFP-LacI; dpy-30p::S65TGFP; dpy-20(+)], oxTi469 [256xLacO + Cbr-unc-119(+) + NeoR]. MiniMos plasmid (pCFJ796) with 256x LacO, Cbr-unc-119(+) and NeoR inserted into syIs46 II; unc-119(ed3) III strain derived from PS2958. May still contain ncl-1 (e1865) III, him-5(e1490)V or dpy-20(e1282ts) IV from PS2958. Neo resistance verified.
EG7525 C. elegans oxTi470 syIs46 II; unc-119(ed3) III. Show Description
syIs46 [hsp16p::GFP-LacI; dpy-30p::S65TGFP; dpy-20(+)], oxTi470 [256xLacO + Cbr-unc-119(+) + PuroR]. MiniMos plasmid (pCFJ797) with 256x LacO, Cbr-unc-119(+) and PuroR inserted into syIs46 II; unc-119(ed3) III strain derived from PS2958. May still contain ncl-1 (e1865) III, him-5(e1490)V or dpy-20(e1282ts) IV from PS2958. Puro resistance verified.
EG7526 C. elegans oxTi471 syIs46 II; unc-119(ed3) III. Show Description
syIs46 [hsp16p::GFP-LacI; dpy-30p::S65TGFP; dpy-20(+)], oxTi471 [256xLacO + Cbr-unc-119(+) + PuroR]. MiniMos plasmid (pCFJ797) with 256x LacO, Cbr-unc-119(+) and PuroR inserted into syIs46 II; unc-119(ed3) III strain derived from PS2958. May still contain ncl-1 (e1865) III, him-5(e1490)V or dpy-20(e1282ts) IV from PS2958. Puro resistance verified.
EG7527 C. elegans oxTi472 syIs46 II; unc-119(ed3) III. Show Description
syIs46 [hsp16p::GFP-LacI; dpy-30p::S65TGFP; dpy-20(+)], oxTi472 [256xLacO + Cbr-unc-119(+) + PuroR]. MiniMos plasmid (pCFJ797) with 256x LacO, Cbr-unc-119(+) and PuroR inserted into syIs46 II; unc-119(ed3) III strain derived from PS2958. May still contain ncl-1 (e1865) III, him-5(e1490)V or dpy-20(e1282ts) IV from PS2958. Puro resistance verified.
EG7528 C. elegans oxTi473 syIs46 II; unc-119(ed3) III. Show Description
syIs46 [hsp16p::GFP-LacI; dpy-30p::S65TGFP; dpy-20(+)], oxTi473 [256xLacO + Cbr-unc-119(+) + PuroR]. MiniMos plasmid (pCFJ797) with 256x LacO, Cbr-unc-119(+) and PuroR inserted into syIs46 II; unc-119(ed3) III strain derived from PS2958. May still contain ncl-1 (e1865) III, him-5(e1490)V or dpy-20(e1282ts) IV from PS2958. Puro resistance verified.
EG7529 C. elegans syIs46 II; unc-119(ed3) III; oxTi474 V. Show Description
syIs46 [hsp16p::GFP-LacI; dpy-30p::S65TGFP; dpy-20(+)], oxTi474 [256xLacO + Cbr-unc-119(+) + PuroR]. MiniMos plasmid (pCFJ797) with 256x LacO, Cbr-unc-119(+) and PuroR inserted into syIs46 II; unc-119(ed3) III strain derived from PS2958. May still contain ncl-1 (e1865) III, him-5(e1490) V or dpy-20(e1282ts) IV from PS2958. Puro resistance verified.
EG7530 C. elegans syIs46 II; unc-119(ed3) III; oxTi475 V. Show Description
syIs46 [hsp16p::GFP-LacI; dpy-30p::S65TGFP; dpy-20(+)], oxTi475 [256xLacO + Cbr-unc-119(+) + PuroR]. MiniMos plasmid (pCFJ797) with 256x LacO, Cbr-unc-119(+) and PuroR inserted into syIs46 II; unc-119(ed3) III strain derived from PS2958. May still contain ncl-1 (e1865) III, him-5(e1490)V or dpy-20(e1282ts) IV from PS2958. Puro resistance verified.
EG7531 C. elegans syIs46 II; unc-119(ed3) III; oxTi476 V. Show Description
syIs46 [hsp16p::GFP-LacI; dpy-30p::S65TGFP; dpy-20(+)], oxTi476 [256xLacO + Cbr-unc-119(+) + PuroR]. MiniMos plasmid (pCFJ797) with 256x LacO, Cbr-unc-119(+) and PuroR inserted into syIs46 II; unc-119(ed3) III strain derived from PS2958. May still contain ncl-1 (e1865) III, him-5(e1490)V or dpy-20(e1282ts) IV from PS2958. Puro resistance verified.
EG7532 C. elegans syIs46 II; unc-119(ed3) III; oxTi477 IV. Show Description
syIs46 [hsp16p::GFP-LacI; dpy-30p::S65TGFP; dpy-20(+)], oxTi477 [256xLacO + Cbr-unc-119(+) + PuroR]. MiniMos plasmid (pCFJ797) with 256x LacO, Cbr-unc-119(+) and PuroR inserted into syIs46 II; unc-119(ed3) III strain derived from PS2958. May still contain ncl-1 (e1865) III, him-5(e1490)V or dpy-20(e1282ts) IV from PS2958. Puro resistance verified.
EG7533 C. elegans syIs46 II; unc-119(ed3) III; oxTi478 V. Show Description
syIs46 [hsp16p::GFP-LacI; dpy-30p::S65TGFP; dpy-20(+)], oxTi478 [256xLacO + Cbr-unc-119(+) + PuroR]. MiniMos plasmid (pCFJ797) with 256x LacO, Cbr-unc-119(+) and PuroR inserted into syIs46 II; unc-119(ed3) III strain derived from PS2958. May still contain ncl-1 (e1865) III, him-5(e1490)V or dpy-20(e1282ts) IV from PS2958. Puro resistance verified.
EG7534 C. elegans oxTi480 syIs46 II; unc-119(ed3) III. Show Description
syIs46 [hsp16p::GFP-LacI; dpy-30p::S65TGFP; dpy-20(+)], oxTi480 [256xLacO + Cbr-unc-119(+) + PuroR]. MiniMos plasmid (pCFJ797) with 256x LacO, Cbr-unc-119(+) and PuroR inserted into syIs46 II; unc-119(ed3) III strain derived from PS2958. May still contain ncl-1 (e1865) III, him-5(e1490)V or dpy-20(e1282ts) IV from PS2958. Puro resistance verified.
EG7535 C. elegans oxTi481 I; syIs46 II; unc-119(ed3) III. Show Description
syIs46 [hsp16p::GFP-LacI; dpy-30p::S65TGFP; dpy-20(+)], oxTi481 [256xLacO + Cbr-unc-119(+) + PuroR]. MiniMos plasmid (pCFJ797) with 256x LacO, Cbr-unc-119(+) and PuroR inserted into syIs46 II; unc-119(ed3) III strain derived from PS2958. May still contain ncl-1 (e1865) III, him-5(e1490)V or dpy-20(e1282ts) IV from PS2958. Puro resistance verified.
EG7536 C. elegans syIs46 II; unc-119(ed3) III; oxTi482 IV. Show Description
syIs46 [hsp16p::GFP-LacI; dpy-30p::S65TGFP; dpy-20(+)], oxTi482 [256xLacO + Cbr-unc-119(+) + PuroR]. MiniMos plasmid (pCFJ797) with 256x LacO, Cbr-unc-119(+) and PuroR inserted into syIs46 II; unc-119(ed3) III strain derived from PS2958. May still contain ncl-1 (e1865) III, him-5(e1490)V or dpy-20(e1282ts) IV from PS2958. Puro resistance verified.
EG7538 C. elegans syIs46 II; unc-119(ed3) oxTi485 III. Show Description
syIs46 [hsp16p::GFP-LacI; dpy-30p::S65TGFP; dpy-20(+)], oxTi485 [256xLacO + Cbr-unc-119(+) + PuroR]. MiniMos plasmid (pCFJ797) with 256x LacO, Cbr-unc-119(+) and PuroR inserted into syIs46 II; unc-119(ed3) III strain derived from PS2958. May still contain ncl-1 (e1865) III, him-5(e1490)V or dpy-20(e1282ts) IV from PS2958. Puro resistance verified.
EG7539 C. elegans syIs46 II; unc-119(ed3) III; oxTi486 V. Show Description
syIs46 [hsp16p::GFP-LacI; dpy-30p::S65TGFP; dpy-20(+)], oxTi486 [256xLacO + Cbr-unc-119(+) + PuroR]. MiniMos plasmid (pCFJ797) with 256x LacO, Cbr-unc-119(+) and PuroR inserted into syIs46 II; unc-119(ed3) III strain derived from PS2958. May still contain ncl-1 (e1865) III, him-5(e1490)V or dpy-20(e1282ts) IV from PS2958. Puro resistance verified.
EG7541 C. elegans oxTi479 I; syIs46 II; unc-119(ed3) III. Show Description
syIs46 [hsp16p::GFP-LacI; dpy-30p::S65TGFP; dpy-20(+)], oxTi479 [256xLacO + Cbr-unc-119(+) + PuroR]. MiniMos plasmid (pCFJ797) with 256x LacO, Cbr-unc-119(+) and PuroR inserted into syIs46 II; unc-119(ed3) III strain derived from PS2958. May still contain ncl-1 (e1865) III, him-5(e1490)V or dpy-20(e1282ts) IV from PS2958. Puro resistance verified.
JK3782 C. elegans qIs56 him-5(e1490) V; qEx557. Show Description
qIs56 [lag-2p::GFP + unc-119(+)] V. qEx557 [hsp-16p::ceh-22b + ttx-3::DsRed]. Him. Pick DsRed+ animals to maintain qEx557 array. Heat-shock can be used to drive the ectopic expression of CEH-22B (derived from Fire Lab vector pPD49.78). LAG-2::GFP is expressed the embryo, nerve cord, Z1/Z4, and DTCs. Reference: Lam N. et al. Curr Biol. 2006 Feb 7;16(3):287-95. doi: 10.1016/j.cub.2005.12.015. PMID: 16461282
NC3540 C. elegans otIs458. Show Description
otIs458[ceh-63p::GFP + unc-119(+)]. GFP expression in DVC neurons. Can be used to isolate DVC by FACS. Derived by outcrossing parental strain OH11974 to remove him-5(e1490). Used by CeNGEN project for RNA-Seq (https://www.cengen.org/).
OH14265 C. elegans pha-1(e2123) III; him-5(e1490) V; otEx6628. Show Description
otEx6628 [srz-54p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218.
OH14838 C. elegans pha-1(e2123) III; him-5(e1490) V; otEx6909. Show Description
otEx6909 [srz-56p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218.
OH14954 C. elegans pha-1(e2123) III; him-5(e1490) V; otEx6947. Show Description
otEx6947 [srz-24p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218.
OH14969 C. elegans pha-1(e2123) III; him-5(e1490) V; otEx6961. Show Description
otEx6962 [srx-44p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218.
OH16636 C elegans pha-1(e2123) III; otIs669 him-5(e1490) V; otEx7603. Show Description
otEx7603 [nlp-52p::GFP + pha-1(+)]. Maintain at 25C to select for animals carrying the array. The nlp-52 reporter construct contains the full intergenic region of nlp-52 as the promoter. GFP expression in a subset of cells of the nervous system. Reference: Reilly MB, et al. bioRxiv 2022.04.29.490095; doi: https://doi.org/10.1101/2022.04.29.490095.
OH16848 C. elegans him-5(e1490)V; otIs518; otIs773. Show Description
otIs518 [eat-4(fosmid)::SL2::mCherry::H2B + pha-1(+)]. otIs773 [inx-19(fosmid)::SL2::YFP::H2B + unc-122::GFP + pha-1(+)]. Integrated fosmid transcriptional reporter for inx-19.
PS9496 C. elegans him-5(e1490) V; seb-3(sy1794) X. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of seb-3 in him-5(e1490) background. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: GAATTGAAAAAACTGGAAAACAGTTCGTATAATCCG right flanking sequence: GGgtgggtcaagttccagtgttcagtttttttaaag inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: ACAGTTCGTATAATCCGGGG Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS9504 C. elegans him-5(e1490) V; str-74(sy1802) X. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of str-74 in him-5(e1490) background. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: GGGAATATTGTTTTCGGGAATAGAAATCCTTGC right flanking sequence: CAGACCATTCGCTCATAATTATAACAACAGTTTGATG inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TATGAGCGAATGGTCTGGCA Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PT3406 C elegans nekl-4(my51[nekl-4::mNeonGreen]) III; him-5(e1490) V. Show Description
mNeonGreen tag inserted into endogenous nekl-4 locus by CRISPR/Cas9 engineering. Very faint mNeonGreen expression in the dendrites, soma, and axons of all ciliated neurons. Reference: Power KM, et al. PLoS Genet. 2020 Oct 16;16(10):e1009052. PMID: 33064774
PT3562 C. elegans sid-2(my95[sid-2::mScarlet]) III; him-5 (e1490) V; myIs4. Show Description
myIs4 [pkd-2p::pkd-2::GFP + unc-122p::GFP]. Phenotypically normal. sid-2::mScarlet is functional in environmental RNAi. Reference: Nikonorova IA, et al. Curr Biol. 2022 Mar 19;S0960-9822(22)00396-7. PMID: 35334227
QP1961 C. elegans eaIs4. Show Description
eaIs4 [him-5p::him-5::GFP::3xFLAG::him-5 3'UTR + unc-119(+)]. Transgene recapitulates published HIM-5 expression patterns and can rescue high incidence of males phenotype of him-5 mutants. Reference: McClendon TB. et al. G3 (Bethesda). 2016 Dec 7;6(12):3913-3925. PMID 27678523.
QP1962 C. elegans eaIs15 III. Show Description
eaIs15 [pie-1p::him-5::GFP::pie-1 3’ UTR + unc-119(+)] III. eaIs15 can rescue high incidence of males phenotype of him-5 mutants. Reference: McClendon TB. et al. G3 (Bethesda). 2016 Dec 7;6(12):3913-3925. PMID 27678523.