feIs4 [sur-5p::luciferase::GFP + rol-6(su1006)] V. pkIs2386 [unc-54p::alphasynuclein::YFP + unc-119(+)]. alphasynuclein::YFP is localized throughout the body-wall muscle cells. Rollers. Strain is bioluminescent when provided with exogenous D-luciferin (potassium salt) due to sur-5 promoter driving expression of firefly (Photinus pyralis) luciferase (lacking the peroxisome tagging signal) fused in-frame to GFP(S65C). Pick animals with high levels of fluorescence to retain expression of luciferase transgene. This strain is for academic use only. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. References: Lagido C, et al. BMC Physiol. 2008 Apr 2;8:7. McLaggan D, et al. PLoS One. 2012;7(10):e46503. Lagido C, et al. Toxicol Sci. 2009 May;109(1):88-95.

feIs5 [sur-5p::luciferase::GFP + rol-6(su1006)] X. pkIs2386 [unc-54p::alphasynuclein::YFP + unc-119(+)]. alphasynuclein::YFP is localized throughout the body-wall muscle cells. Rollers. Strain is bioluminescent when provided with exogenous D-luciferin (potassium salt) due to sur-5 promoter driving expression of firefly (Photinus pyralis) luciferase (lacking the peroxisome tagging signal) fused in-frame to GFP(S65C). Pick animals with high levels of fluorescence to retain expression of luciferase transgene. This strain is for academic use only. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. References: Lagido C, et al. BMC Physiol. 2008 Apr 2;8:7. McLaggan D, et al. PLoS One. 2012;7(10):e46503. Lagido C, et al. Toxicol Sci. 2009 May;109(1):88-95.

feIs5 [sur-5p::luciferase::GFP + rol-6(su1006)] X. dvIs14 [(pCL12) unc-54::beta 1-42 + (pCL26) mtl-2::GFP]. Rollers. mtl-2::GFP produces strong constitutive intestinal expression of GFP at all developmental stages. Expresses human AB peptide and accumulates B-amyloid fibrils. AB toxicity enhanced at higher temperatures. Strain is bioluminescent when provided with exogenous D-luciferin (potassium salt) due to sur-5 promoter driving expression of firefly (Photinus pyralis) luciferase (lacking the peroxisome tagging signal) fused in-frame to GFP(S65C). Pick animals with high levels of fluorescence to retain expression of luciferase transgene. This strain is for academic use only. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. References: Lagido C, et al. BMC Physiol. 2008 Apr 2;8:7. McLaggan D, et al. PLoS One. 2012;7(10):e46503. Lagido C, et al. Toxicol Sci. 2009 May;109(1):88-95.

feIs5 [sur-5p::luciferase::GFP + rol-6(su1006)] X. dvIs15 [(pPD30.38) unc-54(vector) + (pCL26) mtl-2::GFP]. Rollers. Strain is bioluminescent when provided with exogenous D-luciferin (potassium salt) due to sur-5 promoter driving expression of firefly (Photinus pyralis) luciferase (lacking the peroxisome tagging signal) fused in-frame to GFP(S65C). Pick animals with high levels of fluorescence to retain expression of luciferase transgene. This strain is for academic use only. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. References: Lagido C, et al. BMC Physiol. 2008 Apr 2;8:7. McLaggan D, et al. PLoS One. 2012;7(10):e46503. Lagido C, et al. Toxicol Sci. 2009 May;109(1):88-95.

lwIs16 [act-4::lacZ] X. Temperature sensitive gain-of-function allele of ras. At high temperatures worms become Clr. Should also become Muv- not noted. Maintain at 16C.

ccIs55 [unc-54::lacZ + sup-7(st5)] V. Egl. Bags at high frequency. Semi-Clr.

Fails to avoid high osmotic strength solutions of NaCl and fructose. Fails to stain amphids with FITC.

Fails to avoid high osmotic strength solutions of NaCl and fructose. Fails to stain amphids with FITC.

Fails to avoid high osmotic strength solutions of NaCl and fructose. Fails to stain amphids with FITC.

Fails to avoid high osmotic strength solutions of NaCl and fructose. Fails to stain amphid neurons with FITC.

Fails to avoid high osmotic strength solutions of NaCl and fructose. Fails to stain amphid neurons with FITC.

CRISPR/Cas9-engineered deletion of him-5. High incidence of males. Reference: Macaisne N, et al. Genetics (2018) 2010:843-856. PMID 30242011

eaIs4 [him-5p::him-5::GFP::3xFLAG::him-5 3'UTR + unc-119(+)]. Transgene recapitulates published HIM-5 expression patterns and can rescue high incidence of males phenotype of him-5 mutants. Reference: McClendon TB. et al. G3 (Bethesda). 2016 Dec 7;6(12):3913-3925. PMID 27678523.

eaIs15 [pie-1p::him-5::GFP::pie-1 3’ UTR + unc-119(+)] III. eaIs15 can rescue high incidence of males phenotype of him-5 mutants. Reference: McClendon TB. et al. G3 (Bethesda). 2016 Dec 7;6(12):3913-3925. PMID 27678523.

dvIs19 [(pAF15) gst-4p::GFP::NLS] III. Hypomorphic allele of skn-1 that may be propagated as a homozygote. High rate of embryonic lethality and slightly lower brood size compared to N2. Reference: Tang L, Dodd W, Choe K. G3 (Bethesda). 2015 Dec 29.

Hypomorphic allele of skn-1 that may be propagated as a homozygote. High rate of embryonic lethality and slightly lower brood size compared to N2. Reference: Tang L, Dodd W, Choe K. G3 (Bethesda). 2015 Dec 29.

zcIs14 [myo-3::GFP(mit)]. Stable transgenic line expressing GFP at high levels in mitochondria of body wall muscle. Slight developmental delay and reduced brood size observed.

Hermaphrodites seem fine. Males have a high penetrance of anterior displacement of ray 1.

hrtIs3 [des-2p::myr::GFP + unc-122p::DsRed]. hrtEx52 [des-2p::mKate::GS1(high) + unc-119(+) + myo-2p::tdTomato]. Pick tdTomato+ animals to maintain. Myristylated GFP marker for PVD. PVD development is quite strongly affected by high levels of actin-perturbing DeAct-GS1 expression in PVD and FLP. Phenotype is more severe than that of the low DeAct-GS1 expressing strain STR199, but weaker than that of the DeAct-SpvB expressing strain STR200. Reference: Harterink M, et al. J Cell Sci. 2018 Oct 22;131(20):jcs223107. PMID: 30254025.

wdIs51 [F49H12.4::GFP + unc-119(+)]; likely integrated in X. hrtEx53 [des-2p::mKate::GS1(low) + unc-119(+) + myo-2p::tdTomato]. Pick tdTomato+ animals to maintain. PVD development is somewhat affected by moderate levels of actin-perturbing DeAct-GS1 expression in PVD and FLP. Phenotype is less severe than that of the high DeAct-GS1 expressing strain STR198 and DeAct-SpvB expressing strain STR200. Reference: Harterink M, et al. J Cell Sci. 2018 Oct 22;131(20):jcs223107. PMID: 30254025.

dxbp-1(az121) is a K23N mutation that promotes usage of introns starting in UU when the sequence GUU is present at the 5' end of the intron. az121 was initially identified as able to suppress uncoordination of unc-73(e936) by promoting a cryptic splice site that defines an intron beginning UU. smg-4 mutant background allows for high throughput sequencing to identify frame shifted transcripts since it can move the 5'ss over by 1nt. e936az30 has no phenotype on its own, but it offers two adjacent cryptic 5'ss separated by 1nt. Reference: Suzuki JMNGL, et al. PLoS Genet. 2022 Feb 10;18(2):e1010028. doi: 10.1371/journal.pgen.1010028. PMID: 35143478.

High frequency of dauer formation under hyperoxia (90% oxygen) at 20C. Reference: Honda Y, Tanaka M, Honda S, (2008) Exp Gerontol 43:520-9.

Daf-c. Maintain at 15C. Sensitive to hyperoxia and paraquot, comparable to mev-1(kn1) alone. High mutation rate. Extended lifespan measured after mid-adult stage is similar to daf-2(e1370) alone. High mortality rate in early adults. Reference: Honda Y, Tanaka M, Honda S. Exp Gerontol. 2008 Jun;43(6):520-9.

A wild type C. elegans virtually indistinguishable from N2. Males mate with high efficiency, unlike Bergerac. High copy number of Tc1 elements. Active for Tc1 transposition and excision. Not temperature sensitive for growth (unlike Bergerac). See also WBPaper00001053 and WBG 10(2) 140-141 and 11(5) 60. Collected from soil in Madison, WI. Caenorhabditis elegans wild isolate (Tc1 pattern HCD).

teIs90 [(pRL1483) pie-1p::GFP::taf-4 + unc119(+)]. Sick at high temperatures. Maintain at 20C, but it will silence after some generations.

Animals heterozygous for yDp4 are Dpy non-Flu non-Unc. Animals which have lost yDp4 are FluUnc. Animals homozygous for yDp4 are dead (embryonic lethal). Low percentage of non-Dpy non-Unc progeny. These give a high percentage of Unc male self-progeny and are inferred to be yDp4 XO hermaphrodites.

ZK930.1. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok3132 homozygotes (larval arrest). This strain exhibits a high level of sterility or near-sterility in heterozygotes and mIn1 homozygotes, but populations can be maintained. Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: GATAGGTGGATGGCTGGAAA. External right primer: CGAAATGTTGGCTCATCTCA. Internal left primer: TCTCCTTGGCTTCTGTGTCC. Internal right primer: GCTCACTTGGCTCTTCGTCT. Internal WT amplicon: 1200 bp. Deletion size: 789 bp. Deletion left flank: TGTCCAACACGGTGCGTTCATAAATTACAA. Deletion right flank: TTGTCCAACATCAGCCCATCGGACGAAACC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

3xFLAG and eGFP tags inserted into the endogenous hlh-30 locus. Superficially wild-type. Diffuse GFP in basal growing conditions and strong nuclear labeling upon diverse stresses like starvation, Staphylococcus aureus infection, arsenite, diethylmaleate, heat shock or levamisole. GFP expression is only visible at high magnification; not discernible with a fluorescence stereoscope. Insertion can be detected by PCR. Forward primer sequence: 5' acgcacgcaactgcttta; Reverse primer (in 3'UTR): 5' aataacctgcgattctgg; Reverse primer (in eGFP): CTTGAAGAAGATGGTACGCTC. Expected products (For&Rev 3'UTR): 910 bp (WT)/1878 bp (syb1452). Expected products (For&Rev eGFP): no band (WT)/811 bp (syb1452). Insertion allele generated by SunyBiotech and out-crossed twice with VZ Lab N2. Reference: Martina JA, et al. EMBO J. 2021 Feb 1;40(3):e105793

RNAi deficient. Transposon high-hopper strain. Him. Weak sterility.

RNAi deficient. Transposon high-hopper strain. Him. 10% dead embryos probably due to nondisjunction.

High physiological germ-line apoptosis. op234 was originally assigned to gla-1, but cloning revealed it to be a point mutation in cpb-3 causing a C520Y substitution at an invariant cysteine within the conserved C/H domain.

High zinc transcriptional activation - deficient (Zad-d). Avoid high zinc concentrations. Reference: Warnhoff K, et al. PLoS Biol. 2017 Jan 17;15(1):e2000094.

Gain-of-function allele: modified ligand binding domain constitutively binds HZA element. High zinc transcriptional activation - constitutive (Zad-c). Reference: Warnhoff K, et al. PLoS Biol. 2017 Jan 17;15(1):e2000094.

Wt. Synthetic lethal with lin-35/Rb. High % Pun in lin-35 background.

WT. Synthetic lethal with lin-35/Rb. Lower brood size than WT. High % gonad morphogenesis in lin-35 background.

Bacteria. E. coli. Plasmidless, NAL-resistant, ARA-minus, Good growth, high density. Uracil prototroph. Biosafety Level: BSL-1.

oxIs12 [unc-47p::GFP] X. GFP expression in GABA neurons. High regeneration. aex-6 a.k.a. rab-27. Reference: Sekine Y, et al. Cell reports. 2018; 23(2):415-428.

vrEx6 [nst-1p::nst-1::GFP::nst-1 3' UTR + unc-119(+)]. Stable array; high transmission rate and low percentage of mosaicism. Maintain by picking wild-type. Reference: Kudron et al. (2008) PLos Genet 4(8):e1000181.

RNAi deficient (Rde). High incidence of males (Him). fj162 at the second K-rich region is an in-frame duplication (comprising of a small duplication and a tiny inverted duplication) generating 61 extra amino acids. The fj162 mutation can be checked by PCR with the following primers: TCGGATGTTGACTACAACGC and GAAGGTAGAAACTTCATTCCAGCAC.

zdIs13 [tph-1p::GFP] IV. armIs5 [zfp-1(fosmid)::FLAG + unc-119(+)]. Integrated zfp-1 transgene expressed in the germline. Fosmid-based zfp-1::FLAG transgene fully rescues stress-sensitivity and reduced lifespan in zfp-1(ok554) homozygotes. ChIP with anti-FLAG antibody detects ZFP-1::FLAG localization to promoters of highly expressed genes. References: Mansisidor AR, et al. PLoS Genet. 2011 Sep;7(9):e1002299. Avgousti DC, et al. Mol Cell Biol. 2013 Mar;33(5):999-1015. Cecere G, et al. Mol Cell. 2013 Jun 27;50(6):894-907.

zhIs35 [let-23::GFP + unc-119(+)] I. zhIs35 resuces let-23(sy1) and recapitulates LET-23 antibody staining in VPCs. let-23::GFP transgene expression is higher in this strain than in AH1779 unc-119(ed3) III; zhIs38. Reference: Haag A, et al. PLoS Genet. 2014 May 1;10(5):e1004341.

wtfEx496 [pAS3-rig-3p::AI::gur-3G::SL2::tagRFP::unc-54 3'UTR + pAS3-rig-3p::AI::prdx-2G::SL2::tagBFP::unc-54 3'UTR]. Pick animals either BFP or RFP expression in head neurons to maintain. Keep plates covered to avoid unnecessary exposure to light. This strain expresses a purple light-sensitive optogenetic protein system (i.e., GUR-3 and PRDX-2) alongside fluorescent proteins tagBFP and tagRFP in command interneurons AVA, and nearby pharyngeal neurons I1, I4, M4, NSM using rig-3 promoter. Worms exhibit higher reversal rate on exposing to blue light (peak value ~470) compared to controls. Reference: Randi F, et al. (2022). A functional connectivity atlas of C. elegans measured by neural activation. arXiv:2208.04790. https://doi.org/10.48550/arXiv.2208.04790

meIs1 [pie-1p::GFP::lacI + unc-119(+)]. meIs4 [lac-O + rol-6(su1006) + lacO] IV. Pick Rol worms to maintain. This strain throws both Rol and non-Rol worms, seemingly due to random silencing of rol-6(su1006) in the lacO array, meIs4. The strain expresses GFP::LacI in the gonad and embryos that is observed as foci (of lacO target) and nuclear haze. The expression level of GFP::LacI occasionally becomes low possibly due to random silencing of meIs1. If this happens, heat shock the strain at 25°C for 3 days, and pick a clone that exhibits bright GFP signals. Even at the highest expression level, GFP signal is too weak to detect with a fluorescent dissection microscope, and it is necessary to use a regular compound fluorescent microscope with an oil immersion 60X or 100X objective. The NA of the objective should be higher than 1.4. Reference: Bilgir C, et al. G3 (Bethesda). 2013 Mar 11. pii: g3.112.005165v1.

acEx177 [ges-1p::mrp-1::GFP + vha-6::DsRed + unc-122p::RFP]. Pick RFP+ to maintain. Translationally fused MRP-1::GFP expressed under intestinal specific ges-1 promoter, MRP-1::GFP proteins localize at the basolateral membrane of the intestine. Translationally fused VHA-6::RFP expressed under its own promoter, VHA-6::RFP proteins localize at the lumen or luminal membrane of the intestine. For better results, observe fluorescence signals on the L4 stage animals and also under higher magnification microscopy. Reference: Lalsiamthara J & Aballay A. Commun Biol. 2022 May 5;5(1):422. doi: 10.1038/s42003-022-03381-1. PMID: 35513700.

Homozygous viable. Endogenous erm-1 locus tagged with eGFP and modified to mimic ERM-1(T544) phosphorylation. Variant affects ERM-1 localization and dynamics. Reduced brood size, increased embryonic and larval lethality. eGFP-tagged ERM-1 is not fully functional: animals have a reduced brood size and incomplete outgrowth of the excretory canal, but show no other developmental or morphological abnormalities. The penetrance of intestinal phenotypes is slightly higher than in untagged T544 mutants, presumably owing to a detrimental influence of the COOH-terminal GFP tag. Reference: Ramalho JJ, et al. Development. 2020 Jul 22;147(14):dev188011. PMID: 32586975

Homozygous viable. Endogenous erm-1 locus tagged with eGFP and modified to mimic non-phosphorylated ERM-1(T544). Variant affects ERM-1 localization and dynamics. Reduced brood size, increased embryonic and larval lethality. eGFP-tagged ERM-1 is not fully functional: animals have a reduced brood size and incomplete outgrowth of the excretory canal, but show no other developmental or morphological abnormalities. The penetrance of intestinal phenotypes is slightly higher than in untagged T544 mutants, presumably owing to a detrimental influence of the COOH-terminal GFP tag. Reference: Ramalho JJ, et al. Development. 2020 Jul 22;147(14):dev188011. PMID: 32586975

Temperature-sensitive allele. Can be grown at 20C with reduced fertility. Defects in pachytene progression, small oocyte formation and Emo are highly penetrant at 25C. ok154 is a null allele; 1504 bp deletion from -156 bp to +1348 bp, removes the start codon. Reference: Proc Natl Acad Sci USA. Das D, et al. 2022 Jan 18;119(3):e2113649119. PMID: 35022236

Temperature-sensitve. Maintain at 15C. Slight Maternal Effect Lethal (Mel) at 15C, more pronounced at 20C. Highly penetrant Mel at 25C and a fraction of the survivors have reversed left-right organs.

No delta 12 fatty acid desaturase activity. Slow growing. Unc. Dpy. Cold sensitive - maintain at 20C or higher.

ieSi64 [gld-1p::TIR1::mRuby::gld-1 3’UTR + Cbr-unc-119(+)] II. Single copy transgene inserted into chromosome II (oxTi179) expressing a modified Arabidopsis thaliana TIR1 tagged with mRuby in the germ line and early embryos. Comparing to CA1472, this strain expresses a higher level of TIR1 and can induce a faster degradation of AID-tagged proteins in the germ line and early embryos. Reference: Zhang L, et al. Development. 2015 Nov 9. pii: dev.129635.