CB7101 |
C. elegans |
dhs-29(e3014) X. Show Description
Skiddy, bleach-sensitive hermaphrodites. Resistant to infection by Leucobacter Verde1. Reference: O'Rourke et al. (in preparation).
|
|
CB7109 |
C. elegans |
acs-20(e3031) IV; him-5(e1490) V. Show Description
Him. Skiddy, bleach-sensitive hermaphrodites and males. Resistant to Leucobacter Verde1. Reference: O'Rourke et al. (in preparation).
|
|
CB7171 |
C. elegans |
tra-1(e1099) subs-4(e3026) III; eDp6 (III;f). Show Description
Pick wild-type to maintain. Wild-type hermaphrodites segregate wild-type and dead masculinized embryos. e3026 is nonsense mutation in essential gene Y47D3B.1. Reference: O'Rourke et al (in preparation).
|
|
CB7248 |
C.elegans |
dpy-18(e499)/subs-4(e3026) III; wIs78 IV. Show Description
wIs78 [SCMp::GFP + ajm-1p::GFP + F58E10 (cosmid) + unc-119(+)] IV. Heterozygous strain. Wild-type hermaphrodites segregating wild-type, Dpy-18, and dead eggs (subs-4 homozygotes). Pick wild-type to maintain. Reference: Gravato-Nobre et al (in preparation).
|
|
CB7427 |
C. elegans |
unc-17(e245) IV; eEx849. Show Description
eEx849 [C28H8.4(sdmV186E)]. unc-17 missense mutant suppressed by missense C28H8.4 transgene. Pick non-Unc hermaphrodites to maintain. Animals that have lost the array are severely Unc (coilers). Reference: Stroud et al (in preparation).
|
|
CB7430 |
C. elegans |
unc-17(e245) IV; eEx855. Show Description
eEx855 [erd-2(sdmV186E) + sur-5p::GFP]. unc-17 missense mutant partly suppressed by missense erd-2 (a.k.a. sup-2) transgene. Pick GFP+ (weak Unc) hermaphrodites to maintain. Animals that have lost the array are severely Unc (coilers). Reference: Stroud et al (in preparation).
|
|
CF1097 |
C. elegans |
ref-1(mu220) II. Show Description
P9.p and P10.p fail to fuse with hyp7 during L1 in hermaphrodites. Misshapen head (low penetrance) most visible in L1. Ectopic postdeirid generated by V6 (low penetrance).
|
|
CP36 |
C. briggsae |
Cbr-fem-2(nm27) III. Show Description
XX animals have no obvious phenotype: self-fertile with normal brood size. XO animals are self-fertile hermaphrodites with low brood size and some somatic gonad defects. Cbr-fem-2/+ XO animals show late-onset germline feminization. AF16 was the parental strain.
|
|
CP38 |
C. briggsae |
Cbr-tra-1(nm2)/Cbr-let(nm28) III. Show Description
When singled, hermaphrodites should throw 2/3 hermaphrodites and 1/2 nm2 XX males. The lethal appears to balance the nm2 allele pretty well, but precise recombination mapping has not been performed. The XX males maintain their phenotypic resemblance to the unbalanced strain and are probably not fertile due to obvious gonadal deficiencies. This strain has been successfully grown at 15C and 20C. Both strains appear to have complete penetrance of the mutant phenotypes.
|
|
CP87 |
C. briggsae |
Cbr-fem-3(nm63) IV. Show Description
XO are self-fertile hermaphrodites with low brood size and some somatic gonad defects. XX animals have normal brood size.
|
|
CP89 |
C. briggsae |
Cbr-fem-2(nm27) III; Cbr-fem-3(nm63) IV. Show Description
XX are self-fertile hermaphrodites.
|
|
CZ2274 |
C. elegans |
efn-4(bx80) efn-2(ev658) IV; efn-3(ev696) X. Show Description
bx80 was previously called mab-26(bx80): Extensive ray fusion involving all 9 rays; Larva have Vab phenotype with decreasing expressivity in adult; Hermaphrodites have swollen tail and anus. Vab, embryonic ventral enclosure defects, male ray fusions. Slow growth.
|
|
DF22 |
C. elegans |
tlp-1(bx85) unc-24(e138) IV; him-5(e1490) V. Show Description
Unc. Although hermaphrodites appear WT in other ways, there are some problems with T cell lineages (affecting the phasmids) and tail cell fusions. Variably Dyf. Male tail tip morphogenesis is also defective, resulting in blobby, "leptoderan" tails. Males are infertile due to an inability to properly copulate.
|
|
DF64 |
C. elegans |
nyDf1(ny15) IV; him-5(e1490) V. Show Description
Deficiency covers at least all of cosmid T23G4; right breakpoint may be in cosmid C47A4. Fails to complement tlp-1(bx85). Viable and fertile. Although hermaphrodites appear WT in other ways, there are some problems with T cell lineages (affecting the phasmids) and tail cell fusions. Variably Dyf. Male tail tip morphogenesis is also defective, resulting in blobby, "leptoderan" tails. Males are infertile due to an inability to properly copulate.
|
|
DG4384 |
C. elegans |
hmgr-1(tm4386) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I; III). Show Description
Heterozygotes are WT, GFP+ in the pharynx and segregate WT (GFP+ in the pharynx), dead eggs (homozygotes for hT2) and hmgr-1(tm4386) homozygotes, which die as young larvae (L1/L2). Maintain by picking GFP+ worms and checking for correct segregation, since the hT2 balancer is lost at low frequencies. hmgr-1(tm4386) can be maintained as homozygous fertile hermaphrodites on 20 mM mevalonolactone. Reference: P. Ranji, M. Rauthan, C. Pitot and M. Pilon, 2014. PloS ONE 9(6): e100033.
|
|
DH1390 |
C. elegans |
rme-2(b1008) IV. Show Description
Low brood size and incompletely penetrant embryonic lethality. Accumulates yolk in the pseudocoelom of adult hermaphrodites. Males are normal.
|
|
DH202 |
C. elegans |
tra-2(b202) II. Show Description
Temperature sensitive. XX animals are self-fertile hermaphrodites at 15C. XX animals are sterile males at 25C. ts period begins in late embryo.
|
|
DM2 |
C. elegans |
dim-1(ra102) X. Show Description
Body wall muscle is disorganized when viewed using polarized light. Hermaphrodites move well and are indistinguishable from WT under dissecting microscope.
|
|
DM3004 |
C. elegans |
unc-112(r367) V; raDf4/+ X. Show Description
The unc-112(r367); raDf4/+ hermaphrodites move better than unc-112(r367); +/+ animals (but not as well as WT). raDf4 homozygotes arrest as L2 larvae. raDf4 deletes dim-1.
|
|
DM3006 |
C. elegans |
unc-112(r367) V; raDf6/+ X. Show Description
The unc-112(r367); raDf6/+ hermaphrodites move better than unc-112(r367); +/+ animals (but not as well as WT). raDf6 homozygotes arrest during embryogenesis. raDf6 deletes dim-1.
|
|
DM3009 |
C. elegans |
unc-112(r367) V; raDf9/+ X. Show Description
The unc-112(r367); raDf9/+ hermaphrodites move better than unc-112(r367); +/+ animals (but not as well as WT). raDf9 homozygotes arrest as L1 or L2 larvae. raDf9 deletes dim-1.
|
|
DM3010 |
C. elegans |
unc-112(r367) V; raDf10/+ X. Show Description
The unc-112(r367); raDf10/+ hermaphrodites move better than unc-112(r367); +/+ animals (but not as well as WT). raDf10 homozygotes arrest as L1 or L2 larvae. raDf10 deletes dim-1.
|
|
DM3011 |
C. elegans |
unc-112(r367) V; raDf11/+ X. Show Description
The unc-112(r367); raDf11/+ hermaphrodites move better than unc-112(r367); +/+ animals (but not as well as WT). raDf11 homozygotes arrest as L1 or L2 larvae. raDf11 deletes dim-1.
|
|
DM3012 |
C. elegans |
unc-112(r367) V; raDf12/+ X. Show Description
The unc-112(r367); raDf12/+ hermaphrodites move better than unc-112(r367); +/+ animals (but not as well as WT). raDf12 homozygotes arrest as L1 or L2 larvae. raDf12 deletes dim-1.
|
|
DR1410 |
C. elegans |
dpy-27(y56)/qC1 [dpy-19(e1259) glp-1(q339)] III. Show Description
WT strain which segregates WT, Dpy and DpySteriles (or WT Steriles if grown at 15C.) Maintain by picking WT. dpy-27 animals are mildly Dpy and Egl with protruding vulva. Maternal effect: dpy-27 homozygotes from het parent give severe Dpy hermaphrodites which are marginally viable and give more severe Dpy hermaphrodites and WT males. Males are vigorous and mate well. See also WBPaper00002061.
|
|
DR1785 |
C. elegans |
mIn1 [dpy-10(e128)]/unc-4(e120) II. Show Description
WT phenotype. Segregates WT, homozygous Dpy-10 mIn1 and homozygous Unc-4 hermaphrodites. Recombination in this interval is suppressed, and recombinant animals have not been detected in this stock. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to Don Riddle. mIn1 pka mC6.
|
|
DR1790 |
C. elegans |
rol-1(e91)/mT1 II; unc-71(e541)/mT1 [dpy-10(e128)] III. Show Description
Heterozygotes are WT and segregate WT, Roller Uncs, and a few Dpy mT1 homozygotes. mT1 is an apparent II;III translocation: small broods, lots of dead eggs, and exhibits pseudolinkage between rol-1 II and unc-71 III. The Roller phenotype of rol-1 expresses late and cannot be scored before adulthood. Pick non-Unc hermaphrodites and check for correct segregation of progeny.
|
|
DR20 |
C. elegans |
daf-12(m20) X. Show Description
Defective dauer formation. Hermaphrodites accumulate oocytes. Males mate poorly.
|
|
DR2054 |
C. elegans |
mIn1 [unc-4(e120) dpy-10(e128)]/let-552(e2542) rol-1(e91) II. Show Description
Heterozygotes are WT and segregate WT, DpyUnc [mIn1(mc6) homozygotes], and two-fold arrest Let Rol progeny. Well balanced. Male stock. Cross WT males to WT hermaphrodites and check for correct segregation of progeny.
|
|
DR2150 |
C. elegans |
mIn1 [rol-1(e91) dpy-10(e128)]/let-552(e2542) unc-4(e120) II. Show Description
Heterozygotes are WT and segregate WT, DpyRol mIn1 homozygotes and 2-fold arrest Unc larvae. Male stock; mate WT males and WT hermaphrodites to maintain.
|
|
DZ240 |
C. elegans |
fkh-6(ez16)/mIn1 [dpy-10(e128) mIs14] II; him-8(e1489) IV. Show Description
Heterozygotes are WT and GFP+ in the pharynx. mIn1[dpy-10(e128) mIs14] homozygotes are Dpy and GFP+ in the pharynx. Homozygous fkh-6(ez16) hermaphrodites are sterile and have gonadogenesis defects. Homozygous fkh-6(ez16) males are sterile and strong Gon, "white patch" phenotype. 25% of males have a hermaphrodite vulval structure.
|
|
DZ683 |
C. elegans |
tra-2(ar221) II; xol-1(y9) X; rdIs4. Show Description
rdIs4 [ehn-3a::Venus(delta)]. Temperature-sensitive. Must be maintained at 15°C to produce progeny. Strain develops as hermaphrodites at 15°C (some animals are intersex with male tails), and develops as XX pseudomales at 25°C. GFP expressed in gonadal precursors. Reference: Kroetz MB & Zarkower D. G3 (Bethesda). 2015 Oct 23;5(12):2831-41.
|
|
EC100 |
C. elegans |
eeEx100. Show Description
eeEx100 [his-24::GFP + rol-6(su1006)]. Rollers. Nuclear GFP fluorescence detected beginning with the eight-cell stage of the embryo in all somatic nuclei without the P-cell. In adults the GFP signal in somatic cells and in few hermaphrodites in undifferentiated germ nuclei and in oocytes and sperm. About 20% transmission.
|
|
EE67 |
C. elegans |
him-8(e1489) IV; mup-2(e2346) X. Show Description
Temperature sensitive. At 15C the animals are essentially WT, but with a reduced brood; males mate well. Embryos raised at 25C will result in 3-fold/L1 arrest (Mup). Larval shift to 25C will result in sterile hermaphrodites but males that are fertile.
|
|
EM305 |
C. elegans |
efn-4(bx80) IV; him-5(e1490) V. Show Description
Extensive ray fusion involving all 9 rays. Larva have Vab phenotype with decreasing expressivity in adult. Hermaphrodites have swollen tail and anus. bx80 pka mab-26(bx80).
|
|
EM347 |
C. elegans |
tlp-1(bx85) IV; him-5(e1490) V. Show Description
Although hermaphrodites appear WT in other ways, there are some problems with T cell lineages (affecting the phasmids) and tail cell fusions. Variably Dyf. Male tail tip morphogenesis is also defective, resulting in blobby, "leptoderan" tails. Males are infertile due to an inability to properly copulate. tlp-1 encodes a nuclear protein with a single C2H2-type zinc finger domain and an N-terminal "SPLALLA" domain, similar to that of Sp1 transcription factors of vertebrates. The bx85 mutation involves a truncation of TLP-1 due to a frameshift caused by a 5-bp deletion.
|
|
EM435 |
Oscheius myriophila |
Show Description
WT strain. Isolated by D. Fitch in June 1990 from soil in Scott Emmons' compost heap in the Fort Greene section of Brooklyn, NY. A second strain, DF5038, was isolated from the same location one year later from the head and ventral segments of a male pill bug (Armadillidium vulgare). Hermaphroditic. Males are easily isolated by heat shocking L4 or early adult hermaphrodites at 30C for 6-12 hrs. Grows well at 6-25C on OP50. Dauer larvae accumulate under starved or overcrowded conditions. Freezes easily using C. elegans protocols with 90% viability. Previously called Rhabditis sp. See also WBPaper00003418.
|
|
EM599 |
C. elegans |
him-5(e1490) V; lin-15B&lin-15A(n765) X; bxIs13. Show Description
bxIs13 [egl-5::GFP + lin-15(+)]. Him. egl-5::GFP reporter made from EM#286 (GFP inserted within the last few amino acids of the C-terminus) by integrating bxEx30 in EM588. High nuclear expression of transgene in males (good in seam cells, none in rectal epithelium), weak expression in hermaphrodites. Expression in 2-4 head neurons in males and hermaphrodites. egl-5 gene on reporter does not rescue egl-5(-).
|
|
EU1007 |
C. elegans |
mel-26(or543) I. Show Description
Temperature sensitive. Maintain at 15C. At 25C, hermaphrodites lay embryos that die. Transverse PO mitotic spindle, cytokinesis defects. Missense mutation at nucleotide #379 (cyt->tgt); amino acid #127 (R to C).
|
|
EU1077 |
C. elegans |
mel-26(or543) I; him-8(e1489) IV. Show Description
Temperature sensitive. Maintain at 15C. At 25C, hermaphrodites lay embryos that die. Transverse PO mitotic spindle, cytokinesis defects. Missense mutation at nucleotide #379 (cyt->tgt); amino acid #127 (R to C). Throws males.
|
|
EU1513 |
C. elegans |
aph-1(or28)/hT2 I; +/hT2 [bli-4(e937) let-?(h661)] III; lin-2(e1309) X. Show Description
or28 is a non-conditional maternal-effect embryonic lethal mutant ; the anterior pharynx is absent. and embryonic lethality is 100% penetrant. Pick single WT heterozygous hermaphrodites to maintain strain; these hets fill up with a mix of dead embryos and larvae [11/16 dead embryos due to aneuploidy from translocation segregation and lethal homozygous hT2; vulvaless due to homozygous lin-2(e1309) mutation; about 10% of lin-2(e1309) worms are leaky and lay eggs/can be mated into]. The homozygous or28 hermaphrodites fill up with dead embryos. The lin-2 background helps to score embryonic lethality for both heterozygotes and or28 homozygotes. or28 is a G to D mis-sense mutation at amino acid position 123.
|
|
EU1514 |
C. elegans |
aph-1(or28)/hT2 I; +/hT2 [bli-4(e937) let-?(h661)] III; him-8(ec56) IV; lin-2(e1309) X. Show Description
or28 is a non-conditional maternal-effect embryonic lethal mutant ; the anterior pharynx is absent. and embryonic lethality is 100% penetrant. Pick single WT heterozygous hermaphrodites to maintain strain; these hets fill up with a mix of dead embryos and larvae [11/16 dead embryos due to aneuploidy from translocation segregation and lethal homozygous hT2; vulvaless due to homozygous lin-2(e1309) mutation; about 10% of lin-2(e1309) worms are leaky and lay eggs/can be mated into]. The homozygous or28 hermaphrodites fill up with dead embryos. The lin-2 background helps to score embryonic lethality for both heterozygotes and or28 homozygotes. Strain produces a lot of males due to him-8(ec56). or28 is a G to D mis-sense mutation at amino acid position 123.
|
|
EU1515 |
C. elegans |
aph-1(or28)/hT2 I; +/hT2 [bli-4(e937) let-?(h661)] III; him-8(ec56) IV. Show Description
Him. or28 is a non-conditional maternal-effect embryonic lethal mutant ; the anterior pharynx is absent. and embryonic lethality is 100% penetrant. Pick single WT heterozygous hermaphrodites to maintain strain; these hets produce 11/16 dead embryos due to aneuploidy from translocation segregation and lethal homozygous hT2. The homozygous or28 hermaphrodites produce all dead embryos with defective pharyngeal development. or28 is a G to D mis-sense mutation at amino acid position 123.
|
|
EU1516 |
C. elegans |
aph-1(or28)/hT2 I; +/hT2 [bli-4(e937) let-?(h661)] III. Show Description
or28 is a non-conditional maternal-effect embryonic lethal mutant ; the anterior pharynx is absent. and embryonic lethality is 100% penetrant. Pick single WT heterozygous hermaphrodites to maintain strain; these hets produce 11/16 dead embryos due to aneuploidy from translocation segregation and lethal homozygous hT2. The homozygous or28 hermaphrodites produce all dead embryos with defective pharyngeal development. or28 is a G to D mis-sense mutation at amino acid position 123. Strain produces lots of males due to him-8(ec56).
|
|
EU593 |
C. elegans |
mel-26(or184) I. Show Description
Temperature sensitive. Maintain at 15C. At 25C, hermaphrodites lay embryos that die. Transverse PO mitotic spindle, cytokinesis defects. Missense mutation at nucleotide #245 (gga->gaa); amino acid #82 (G to E).
|
|
EU828 |
C. elegans |
dhc-1(or195) I. Show Description
Homozygous or195 hermaphrodites make 100% dead embryos at 26C. One-cell embryo has a very small but bipolar spindle, severe chromosome segregation defect. Maintain at 15C. Previously called spd-4. 2/06: From Bruce Bowerman: The or195 mutation changes base 10,679 of the cosmid clone T21E12 from a C to a T. This corresponds to dhc-1 cDNA nucleotide 9599 (WS153) , which is the center nucleotide of codon 3200. This codon changes from Serine in N2 to Leucine in or195 (S3200L). Note: this is not the same mutation for or195ts that we reported in Hamill et al, 2002(Dev Cell 3, 673-684). The mutation reported in our paper is not present in this strain. We apologize for the confusion. The pairs dhc-11a,b amplify the mutated fragment in dhc-1(or195). The mutation is near the center of this fragment; a clean (gel purified) DNA prep helps get a good read of it. dhc-11b: 5' aacagacgcacgattgacct 3'. dhc-11a: 5' ctcaaatcaaggaaggagct 3'. PCR conditions: 5 min at 94 degrees C; 30 sec at 94 degrees C; 30 sec at 55 degrees C; 1 min at 72 degrees C. 35 Cycles using Taq polymerase.
|
|
EU856 |
C. elegans |
spd-5(or213) I. Show Description
Homozygous or213 hermaphrodites make 100% dead embryos at 26C. No mitotic spindle assembly. Maintain at 15C.
|
|
EW15 |
C. elegans |
bar-1(ga80) X. Show Description
[NOTE: (10/22/2020) This strain also carries a (T to A) missense mutation in pry-1 which results in a PRY-1 N354K amino acid substitution.] bar-1(ga80) hermaphrodites are usually Egl and often have a protruding vulva (Pvl), although approx. 40% of animals appear WT on plates. Also slightly Unc. In bar-1(ga80) hermaphrodites any of the six vulval precursor cells (P3.p - P8.p) can sometimes fuse with hyp7 without dividing, and P5.p - P7.p can adopt the tertiary cell fate instead of the primary or secondary fates. In addition, the neuroblast QL and its progeny migrate towards the anterior instead of the posterior, and the cell P12 usually adopts the fate of P11. bar-1(ga80) do mate, but poorly. bar-1 encodes a beta-catenin molecule and the ga80 mutation is predicted to cause an early truncation of the protein.
|
|
GE42 |
C. elegans |
vab-7(e1562) pha-1(e2123) III. Show Description
Temperature sensitive. Maintain at 15C. pha-1(e2123) is embryonic lethal at 25C. Hermaphrodites have an abnormal tail: sometimes twisted, tail whip never formed, often bobbed; sometimes uncoordinated with bent tail. Adult male tail deformed also.
|
|
GS445 |
C. elegans |
lin-25(ar90) V/nT1 [unc-?(n754) let-?] (IV;V). Show Description
Heterozygotes are Unc and segregate Uncs, dead eggs, and Egl. lin-25(ar90) is a probable null mutation. Hermaphrodites are completely unable to lay eggs. Lineage defects in VPCs. Amber mutation (codon 197); amber suppressable. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|