Search Strains

wpIs98 [itr-1pB::Chrimson::SL2::mCherry + odr-1p::RFP] I. Chrimson is expressed in DA9. Use 100 uM ATR in OP50 for optogenetic experiments. Reference: Ding C & Hammarlund M. Elife. 2018 Oct 29;7. pii: e38829. doi: 10.7554/eLife.38829.

wpIs98 [itr-1pB::Chrimson::SL2::mCherry + odr-1p::RFP] I. wpIs103 [myo-3p::GCaMP6 + myo-2p::mCherry].  ric-7 causes defective expulsion during defecation and slightly slow growth. Chrimson is expressed in DA9. GCaMP6 expressed in body wall muscles. Use 100 uM ATR in OP50 for optogenetic experiments. Reference: Ding C & Hammarlund M. Elife. 2018 Oct 29;7. pii: e38829. doi: 10.7554/eLife.38829.

wpIs103 [myo-3p::GCaMP6 + myo-2p::mCherry].  GCaMP6 expressed in body wall muscles. Can be used to monitor the activity of postsynaptic body wall muscles (BWM) during DA9 regeneration. Reference: Ding C & Hammarlund M. Elife. 2018 Oct 29;7. pii: e38829. doi: 10.7554/eLife.38829.

wpIs98 [itr-1pB::Chrimson::SL2::mCherry + odr-1p::RFP] I. Reference: Ding C & Hammarlund M. Elife. 2018 Oct 29;7. pii: e38829. doi: 10.7554/eLife.38829.

ufIs92 [unc-47p::acr-12::GFP].  wpIs109 [itr-1pB::mCherry + odr-1p::RFP]. ric-7 causes defective expulsion during defecation and slightly slow growth. ACR-12::GFP expression in GABA neurons. DA9 is labeled with mCherry. Reference: Ding C & Hammarlund M. Elife. 2018 Oct 29;7. pii: e38829. doi: 10.7554/eLife.38829.

oyIs14 [sra-6p::GFP + lin-15(+)]. sra-6p::GFP marks both PVQ neurons as well as the ASI and ASH neurons in the head. Reference: Ding C, et al. Elife. 2022 Mar 14;11:e73557. PMID: 35285800.

wp78 is a CRISPR/Cas9-engineered 11.5 kb deletion removing the entire coding region of casy-1, the C. elegans homolog of calsyntenin. casy-1(wp78) phenocopies the casy-1(wp60) point mutation and strongly suppresses PVQ degeneration in both ric-7(n2657) and miro-1(wy50180); mtx-2(wy50266) mutants. Reference: Ding C, et al. Elife. 2022 Mar 14;11:e73557. PMID: 35285800.

oyIs14 [sra-6p::GFP] V. wpEx369 [sra-6p::mito::TagRFP + odr-1p::RFP]. Maintain by picking animals with red fluorescence. PVQ neurons are marked with integrated GFP marker. Mitochondria in PVQ neurons are visualized with sra-6p::mito::TagRFP. Reference: Ding C, et al. Elife. 2022 Mar 14;11:e73557. doi: 10.7554/eLife.73557. PMID: 35285800.

Reference: Roerink SF, et al. PLoS Genet. 2012 Jun;8(6):e1002800.

Reference: Roerink SF, et al. PLoS Genet. 2012 Jun;8(6):e1002800.

lfIs129 [elt-2p::GFP-HReporter + rol-6(su1004) + P(HS)::ISceI::mCherry]. Rollers. Reference: Roerink SF, et al. PLoS Genet. 2012 Jun;8(6):e1002800.

pkIs2170 [hsp-16.41::ATG-LacZ(first 251nt)-I-Sce-I site-stops-LacZ + unc-119(+)]. pkIs2379 [hsp-16.41::I-Sce-I ORF + rol-6(su1006)]. Reference: Pontier DB &Tijsterman M. Nat Methods. 2009 Sep;6(9):655-7.

vab-1 null and itr-1 gain of function. Viable. Unc.

Negative regulator of oocyte maturation. Male/female strain.

Heterozygotes are Unc with pharyngeal GFP signal. Homozygous hT2[bli-4 let-? qIs48] are inviable. Homozygous unc-43(n498); fog-3(q443) animals are females.

Negative regulator of oocyte maturation.

Negative regulator of oocyte maturation. Male/Female strain.

Maintain at 20C for best fecundity and most rapid development. Variable temperature-sensitive phenotypes. 20C: wild type; 22C: hypoxia resistant and long lifespan; 25C fully penetrant L3 developmental arrest. daf-15(bgg95) is an engineered I1033K missense mutation that also introduced three silent wobble mutations in nearby bases affecting restriction sites (cagGTTGCCCGAATGGCTCAAAAAATAGTGCAT -> cagGTGGCACGGATGGCTCAAAAAAAAGTGCAT). Strain can be genotyped by digest with either Bcc1 (silent wobble mutation generates additional cut in bgg95) or with Bgl1 (silent wobble mutation eliminates cut in bgg95). daf-15 crRNA: aucucgucagguugcccgaa. Repair ssODN: CATTTCGGGCATTCCTGCTTCGACGCGATGCACTTTTTTTTGAGCCATCCGTGCCACCTGACGAGATGTATTGGTTGTATTACACAGAC. Reference: Sun CL, et al. Curr Biol. 2025 Jun 9;35(11):2567-2582.e5. doi: 10.1016/j.cub.2025.04.040. PMID: 40339571.

1.5 kb of M79.1 locus is deleted which corresponds to the elimination of exons 8-12, including the kinase domain and 2/3 of the SH2 domains.

opIs219 contains [ced-4p::ced-4::GFP].

Derived from VC146. Made as model for Batten disease. Reference: de Voer G, et al. J Inherit Metab Dis. 2005;28(6):1065-80.

Made as model for Batten disease. Derived from XT1 and XT3. Reference: de Voer G, et al. J Inherit Metab Dis. 2005;28(6):1065-80.

Made as model for Batten disease. Derived from XT1 and XT2. Reference: de Voer G, et al. J Inherit Metab Dis. 2005;28(6):1065-80.

Made as model for Batten disease. Derived from XT2 and XT3. Reference: de Voer G, et al. J Inherit Metab Dis. 2005;28(6):1065-80.

Decreased brood size, mild life-span reduction. Made as model for Batten disease. Derived from XT2 and XT4. Reference: de Voer G, et al. J Inherit Metab Dis. 2005;28(6):1065-80.

qxIs722 [dpy-7p::dpy-7::SfGFP (single copy)]. qxIs722 is a single copy insertion into ttTi5605 via CRISPR/Cas9. DPY-7::SfGFP expression in cuticle over hyp7. Reference: Miao R, et al. Dev Cell. 2020 Jan 6;52(1):21-37.e5.

qxIs257 [ced-1p::nuc-1::mCherry + unc-76(+)]. Integrated nuc-1::mCherry transgene marking lysosomes in epidermal cells. Site of chromosomal integration unknown. Not known if unc-76(e911) is still present in background. Reference: Li Y, et al. J Cell Biol. 2016 Oct 24;215(2):167-185.

qxIs430 [scav-3::GFP + unc-76(+)]. Integrated GFP translational fusion transgene marking lysosomes in epithelial cells. Not known if unc-76(e911) is still present in background. Reference: Li Y, et al. J Cell Biol. 2016 Oct 24;215(2):167-185.

1213 bp deletion corresponding to bp 30458-31670 on cosmid F52B5. Takes out a large part of the cep-1 open reading frame.

yakEx126 [unc-17p::hif-1(cDNA) + myo-2p::mCherry]. Pick animals with red pharynx to maintain. HIF-1 expressed from cholinergic neuron-specific promoter in hif-1 mutant background for tissue-specific rescuing experiments. yakEx126 does not rescue lethality in hif-1 mutant animals exposed to 50ppm hydrogen sulfide. Reference: Topalidou I & and Miller DL. bioRxiv 174581; doi: https://doi.org/10.1101/174581.

yakEx131 [eft-3p::hif-1(cDNA) + myo-2p::mCherry]. Pick animals with red pharynx to maintain. HIF-1 expressed from a ubiquitous promoter in hif-1 mutant background for tissue-specific rescuing experiments. yakEx131 rescues lethality in hif-1 mutant animals exposed to 50ppm hydrogen sulfide. Reference: Topalidou I & and Miller DL. bioRxiv 174581; doi: https://doi.org/10.1101/174581.

yakEx137 [unc-14p::hif-1(P621A)::YFP + myo-2p::mCherry]. Pick animals with red pharynx to maintain. Non-degradable form of HIF-1 tagged with YFP expressed from unc-14 promoter in hif-1 mutant background for tissue-specific rescuing experiments. yakEx137 rescues lethality in hif-1 mutant animals exposed to 50ppm hydrogen sulfide. Reference: Topalidou I & and Miller DL. bioRxiv 174581; doi: https://doi.org/10.1101/174581.

yakEx142 [unc-14p::hif-1(cDNA) + myo-2p::mCherry]. Pick animals with red pharynx to maintain. unc-14 promoter drives GFP expression in several tissues including neurons, intestine, muscle, hypodermis. Reference: Topalidou I & and Miller DL. bioRxiv 174581; doi: https://doi.org/10.1101/174581.

yakEx143 [dpy-7p::hif-1(cDNA) + myo-2p::mCherry]. Pick animals with red pharynx to maintain. HIF-1 expressed from a hypodermal-specific promoter in hif-1 mutant background for tissue-specific rescuing experiments. yakEx143 does not rescue lethality in hif-1 mutant animals exposed to 50ppm hydrogen sulfide. Reference: Topalidou I & and Miller DL. bioRxiv 174581; doi: https://doi.org/10.1101/174581.

yakEx144 [unc-14p::hif-1(cDNA) + myo-2p::mCherry]. Pick animals with red pharynx to maintain. HIF-1 expressed from unc-14 promoter in hif-1 mutant background for tissue-specific rescuing experiments. yakEx144 rescues lethality in hif-1 mutant animals exposed to 50ppm hydrogen sulfide. Reference: Topalidou I & and Miller DL. bioRxiv 174581; doi: https://doi.org/10.1101/174581.

yakEx145 [unc-47p::hif-1(cDNA) + myo-2p::mCherry]. Pick animals with red pharynx to maintain. HIF-1 expressed from GABA-ergic neuron-specific promoter in hif-1 mutant background for tissue-specific rescuing experiments. yakEx145 does not rescue lethality in hif-1 mutant animals exposed to 50ppm hydrogen sulfide. Reference: Topalidou I & and Miller DL. bioRxiv 174581; doi: https://doi.org/10.1101/174581.

yakEx125 [rab-3p::hif-1(cDNA) + myo-2p::mCherry]. Pick animals with red pharynx to maintain. HIF-1 expressed from pan-neuronal-specific promoter in hif-1 mutant background for tissue-specific rescuing experiments. yakEx125 does not rescue lethality in hif-1 mutant animals exposed to 50ppm hydrogen sulfide. Reference: Topalidou I & and Miller DL. bioRxiv 174581; doi: https://doi.org/10.1101/174581.

yp2 mutation perturbs the MRT-1 DNA-binding domain. Mortal germline. Progressive telomere shortening due to telomerase dysfunction. Hypersensitive to DNA interstrand crosslinking agents. This strain will become sterile after propagating 10-20 generations. mrt-1 mutants can be rejuvenated by outcrossing. Reference: Meier B, et al. EMBO J. 2009 Nov 18;28(22):3549-63.

Becomes very sick if starved for extended periods of time or if frozen and thawed repeatedly. Primer sequences provided by the C. elegans Reverse Genetics Core Facility for ok410 are: Outer Left Sequence: AAGACTGTCAGCTGGTGGGT. Outer Right Sequence: TTAGCCTTACATTGCCGCTT. Inner Left Sequence: TCATGCGCAACATCTAAAGC. Inner Right Sequence: CGAATAAAGCAATTTCCCGA. Inner primer WT PCR product: 2825.

Null allele. Mortal germline. Progressive telomere shortening due to telomerase dysfunction. Hypersensitive to DNA interstrand crosslinking agents. This strain will become sterile after propagating 10-20 generations. mrt-1 mutants can be rejuvenated by outcrossing. Reference: Meier B, et al. EMBO J. 2009 Nov 18;28(22):3549-63.

Null allele. Mortal germline. Progressive telomere shortening due to telomerase dysfunction. Hypersensitive to DNA interstrand crosslinking agents. This strain will become sterile after propagating 10-20 generations. mrt-1 mutants can be rejuvenated by outcrossing. Reference: Meier B, et al. EMBO J. 2009 Nov 18;28(22):3549-63. [NOTE: allele is incorrectly described as e2661 in this publication.]

Defective avoidance to water-soluble repellent. Reference: Aoki R., et al. J Neurosci. 2011 Nov 16;31(46):16603-10.

Defective avoidance to water-soluble repellent. Reference: Aoki R., et al. J Neurosci. 2011 Nov 16;31(46):16603-10.

Homozygous viable mutation balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok2421 homozygotes. Pick WT dim GFP and check for correct segregation of progeny to maintain. ok2421 homozygotes are morphologically wild-type but show ~30% reduction in fertilized eggs and a trans-generational increase in sterility. Maintain under normal conditions. Reference: Bickel JS, et al. PLoS Genet. 2010 Jul 22;6(7):e1001028.