More Fields
Strain Species Genotype
VC1733 C. elegans nekl-2(gk839) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
ZC581.1. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP gk839 homozygotes (probable embryonic arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: AAGCGCCCTCTAAATTGTCA. External right primer: GCAGATTTCGTTCCAAGCTC. Internal left primer: TCTTTGTTAGCCATTTCCGC. Internal right primer: GAACAGTCTTTCGGCGATTC. Internal WT amplicon: 1654 bp. Deletion size: 506 bp. Deletion left flank: ATTTCTTGCCGTTTCGTTGAAATTGTTAAC. Deletion right flank: TGTGTTATAATCTACTAACTTTATAATTTA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1741 C. elegans spe-11(ok2143) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
F48C1.7. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2143 homozygotes (sterile, lays unfertilized oocytes). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: ACTGGGTGCAAAACAGGTTC. External right primer: GGCTTACAGCTCTTGGTGGA. Internal left primer: GACCAAATTGAAGCGCATTT. Internal right primer: GAACATTTTTCCGTCAACCG. Internal WT amplicon: 2133 bp. Deletion size: 1196 bp. Deletion left flank: TCTCCAAACTCACTTATTGGAAAAAGCGTC. Deletion right flank: ATAAGTGAGATATCGGCCAAGCAATAGGAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1752 C. elegans Y23H5A.2&cars-1(ok2280) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Y23H5A.2, Y23H5A.7. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2280 homozygotes (mid-larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CTCCATGGAAAAGATCCGAA. External right primer: TGGAACGGAGGTAAAACGAC. Internal left primer: ACCCCATATCGTGTCAATGG. Internal right primer: ACGGATTCAAGATCTGGTGG. Internal WT amplicon: 2132 bp. Deletion size: 475 bp. Deletion left flank: CAACGCGACCGCCGAAGCCGCACAATTCTG. Deletion right flank: TTCTCCGGATCTCGAAGAAAAACGCCGTTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1774 C. elegans nekl-2(gk841) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
ZC581.1. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP gk841 homozygotes (probable embryonic arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: AAGCGCCCTCTAAATTGTCA. External right primer: GCAGATTTCGTTCCAAGCTC. Internal left primer: TCTTTGTTAGCCATTTCCGC. Internal right primer: GAACAGTCTTTCGGCGATTC. Internal WT amplicon: 1654 bp. Deletion size: 354 bp. Deletion left flank: TTCAAATGGACAATTATGAAAAAGTGCGTG. Deletion right flank: TATTGATTCTTTTATTATGGATAATCAACT. Insertion Sequence: ATC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1787 C. elegans C17E4.6(ok2296) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
C17E4.6. Homozygous viable deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2296 homozygotes (viable Unc, sickly, BMD, vulval defects). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CACGACCTCTTGGACGAAAT. External right primer: CCAACCCCAACTGCCTACTA. Internal left primer: AGTGCGAGTGCGTTACACTG. Internal right primer: GGAGCCATAGTCGAGAGACG. Internal WT amplicon: 2597 bp. Deletion size: 1233 bp. Deletion left flank: GATGATATTCTAGCTAAGAACAAGAAATGG. Deletion right flank: TCAACGACGACAACTCTACCAGTCAACGTC. Insertion Sequence: C. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1825 C. elegans F44E2.8&F44E2.9(ok2134) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
F44E2.8, F44E2.9. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2134 homozygotes (sterile, lays no eggs). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GAGCTGGTTGGTTTCACCAT. External right primer: ATATGTGGAACTTGCCGGAG. Internal left primer: CATTGGAGAGAGCTTAGGCG. Internal right primer: TCGTTTTTAAATTTCCGCCA. Internal WT amplicon: 2111 bp. Deletion size: 1195 bp. Deletion left flank: TTTTTGTCGAACTTCATTCTTTACTTTACT. Deletion right flank: GGAAATAAAATCGATAAAAACTTTAAAATT. Insertion Sequence: CACGACTTCCTGTTTCTTCAGAAAAACTCTGAATGGCCGTTTCCCATTTTGCT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1828 C. elegans tag-164&abcf-2(ok2388) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Y76A2A.1, T27E9.7. Homozygous viable deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2388 homozygotes (small, sickly, tends to die out but populations are possible to maintain). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GGAAGCAGTTGATAGCCTCG. External right primer: CGTCGCTTTTTCCGTGTATT. Internal left primer: ATAGCTGTTTCATCGGGCAC. Internal right primer: AATTTAGGGTACCCCATCCG. Internal WT amplicon: 3031 bp. Deletion size: 1245 bp. Deletion left flank: CAGGCTAAATTAGCATATTTACACAGACGA. Deletion right flank: CCGCTTGAAGAGCAGTTTTCTCTGAAGCAG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1831 C. elegans vha-16(ok2332) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
C30F8.2. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2332 homozygotes (probable embryonic arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CCAGATCCAGGAAGGAATGA. External right primer: CGAAAATAATTGCAGCCCAT. Internal left primer: TTGCGAAGCCGATTTAGTTT. Internal right primer: TTCTTTCGCCTCCTTTTTCA. Internal WT amplicon: 2112 bp. Deletion size: 831 bp. Deletion left flank: TTTCGAAAAACCAGGCCGTAAACTGACAGC. Deletion right flank: TTTTTTTTCAAATTAAATTATTATACAACT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1833 C. elegans sem-2(ok2422) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
C32E12.5. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2422 homozygotes (embryonic or early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: AACGAATGAAAACTGGCTCG. External right primer: ATATGATGCCGCCGATTAAC. Internal left primer: CAATCGCTTGGATTTGTTGA. Internal right primer: CAATTGCAGTAGCCTCATCG. Internal WT amplicon: 3044 bp. Deletion size: 2389 bp. Deletion left flank: AAGTTGGTGCTGGTGATGGTGCGAAGTGGT. Deletion right flank: CCAGAAGTCGATGAGGCTACTGCAATTGCG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1835 C. elegans T28D6.6&pen-2(ok2449) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
T28D6.9, T28D6.6. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2449 homozygotes (sterile, lays no eggs). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TTCGTCGTTTCTCGCTTTTT. External right primer: CTACGTGGAAACCGTGGAGT. Internal left primer: CCCGTGTGCCTGTAAGTTTT. Internal right primer: CTTAAAGGCGCATATCCCAA. Internal WT amplicon: 2150 bp. Deletion size: 1227 bp. Deletion left flank: TCCAGATATTGCCATAAATTTAGAGAAAAT. Deletion right flank: TTCGATTTTTTTCTGAAAAATTCAAAAATT. Insertion Sequence: ATA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1847 C. elegans T28D6.6&pen-2(ok2395) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
T28D6.9, T28D6.6. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2395 homozygotes (grotty sterile). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TTCGTCGTTTCTCGCTTTTT. External right primer: CTACGTGGAAACCGTGGAGT. Internal left primer: CCCGTGTGCCTGTAAGTTTT. Internal right primer: CTTAAAGGCGCATATCCCAA. Internal WT amplicon: 2150 bp. Deletion size: 832 bp. Deletion left flank: CGGCCTCGATATCCGCGATTTTTTGCAAAA. Deletion right flank: GATTTTTTTCTGAAAAATTCAAAAATTTCA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1848 C. elegans mom-5(gk812) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
T23D8.1. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP gk812 homozygotes (sterile, eggs don't hatch). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TGTGTGTGCTCCGTTCTCTC. External right primer: AATCGGTCGAACTGGATACG. Internal left primer: GCACTTGGAACCAATGTCAA. Internal right primer: AATGAACATTCAGGAAGGCG. Internal WT amplicon: 1742 bp. Deletion size: 567 bp. Deletion left flank: TTTTAGCTATTTACTTAAGTTCGGTTTTTT. Deletion right flank: AAAAGTTTGGATTTCAATGGCCAGATCAAT. Insertion Sequence: GAAAAAGTTTGG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1868 C. elegans F39H11.1(ok2247) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
F39H11.1. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2247 homozygotes (mid- to late-larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GACTTCGTCGTGAGCATTCA. External right primer: ATTCTTAACCGTGCGACACC. Internal left primer: CATCATAAAGCATGTGCGCT. Internal right primer: TGTCGCTGCTCAGAAGAAGA. Internal WT amplicon: 2222 bp. Deletion size: approximately 400 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1875 C. elegans dnc-2(ok2249) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
C28H8.12. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2249 homozygotes (early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: ACCACTGACCCGATTTCTTG. External right primer: AACAATCGAACGTTTTTGCC. Internal left primer: AAATGTGATAGTCCACCGGC. Internal right primer: CCGGTAGAGCGCAGTAACTC. Internal WT amplicon: 1224 bp. Deletion size: 707 bp. Deletion left flank: TCAAGTTTGGTAAGCATCATATTCAAACGT. Deletion right flank: TTTTCAGGTTCACTTTTTTGAACTTGACTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1885 C. elegans spe-11(ok2213) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
F48C1.7. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2213 homozygotes (sterile, lays unfertilized oocytes). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: ACTGGGTGCAAAACAGGTTC. External right primer: GGCTTACAGCTCTTGGTGGA. Internal left primer: GACCAAATTGAAGCGCATTT. Internal right primer: GAACATTTTTCCGTCAACCG. Internal WT amplicon: 2133 bp. Deletion size: 1051 bp. Deletion left flank: TGGGATGAATTTATGTGCAACATGCTCGTA. Deletion right flank: ACATTTTTATCATTATAACGAATATTCATA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1886 C. elegans sbp-1(ok2363) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Y47D3B.7. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2363 homozygotes (early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GATGCCACTTGTTCAGGGTT. External right primer: GCATGAGAGTTACACGCGAA. Internal left primer: TGGAGACATGTACCCGTTGA. Internal right primer: ATCACACGAGCCCTCAGAAC. Internal WT amplicon: 2759 bp. Deletion size: 1315 bp. Deletion left flank: TGCTTGATAAGACCCCCCTCTACTGCAACA. Deletion right flank: CAAAATCAGAACTCAAAAGCAAAGAAGGAG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1898 C. elegans Y66D12A.24&tin-10(ok2400) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Y66D12A.22, Y66D12A.24. Homozygous lethal or sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2400 homozygotes (late larval arrest or sterile adult). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TGGCTCACTTGACACTTTCG. External right primer: TGGGGAAAATCGAAAACTTG. Internal left primer: CTGTGCAATTTGTGATTGCC. Internal right primer: ATATGTACCGCCGAATGACC. Internal WT amplicon: 2686 bp. Deletion size: 1690 bp. Deletion left flank: TTCATTTTGGCTAATTTCTCAGTAAAAATT. Deletion right flank: TTCGATTTAAAAAAAATCGATTTTTTTCAC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1906 C. elegans ceh-45(gk1015) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
ZK993.1. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP gk1015 homozygotes (probable early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GAATGGAGAGACGGGTGTGT. External right primer: TTGAAAATTGTGAAGCTGCG. Internal left primer: GGCGCCAGAGTTTGATCTAC. Internal right primer: AGGTTGATGTGGACGGAGAG. Internal WT amplicon: 1907 bp. Deletion size: 1113 bp. Deletion left flank: CAAAATCTTGGTAGTCTAGAAAACCCCAAT. Deletion right flank: CATGGTGTCCTAGGAATATTTTTAAAAAAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1910 C. elegans ncl-1(ok2555) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
ZK112.2. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2555 homozygotes (probable early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TTCGCCAATATGGGACTCTC. External right primer: GGATGATACGGCTTTGTGCT. Internal left primer: AGCCATTCCTGTTCCAAATG. Internal right primer: GATTGGACTTCCTCCGTGAA. Internal WT amplicon: 3295 bp. Deletion size: 1644 bp. Deletion left flank: AACAAATGCTCAAAATGGAGCAATTGATTG. Deletion right flank: TTCTCTCGTAGATTGATGTCCTTCGCGTCG. Insertion Sequence: AATTCTCAAG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1930 C. elegans mrps-30(ok2469) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
B0511.8. Homozygous lethal or sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2469 homozygotes (late larval arrest or sterile adult, Unc, lays no eggs). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TCCAAATGCCTATCGAGACC. External right primer: CCCGAATCTCCTAATGCTCA. Internal left primer: AGCATTTTTCTGCGTCCCTA. Internal right primer: ACACGCCCTGCTACTGATCT. Internal WT amplicon: 2582 bp. Deletion size: 1317 bp. Deletion left flank: GAACACTCAAATATTGTCCATTTTTATCAC. Deletion right flank: GTGTGTCTTCATCAGAAAAGTTGATTCCAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1932 C. elegans T07A5.5&unc-69(ok2448) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
T07A5.6, T07A5.5. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2448 homozygotes (early- to mid-larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: ACGTGTAACCACTTCTCGCC. External right primer: CTTCATCGATCGGCTTTTGT. Internal left primer: CGGCTGTGAACTCATGACATA. Internal right primer: ATTCAAAGCTCGAGCCAAAA. Internal WT amplicon: 2903 bp. Deletion size: 1464 bp. Deletion left flank: GAGCATGAGCATCGCGATTCCAAGAATGTT. Deletion right flank: ATATTTAGTGTAGTAAAACTGTTACGAGTG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1946 C. elegans pbs-6&cids-1(ok2511) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
C02F5.4, C02F5.9. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2511 homozygotes (early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: AATCGAAGCGGTACTTGTGG. External right primer: CTTTCCTGCATCAAGCATCA. Internal left primer: TTTCTTCAATTGGAGGACATCT. Internal right primer: ATTCCAGGAAGATCGAGCAA. Internal WT amplicon: 2526 bp. Deletion size: 1604 bp. Deletion left flank: AATACTGGCTTACAAAATTTGAATCTTCTC. Deletion right flank: GAAGATCGAATCAAGGCAGATTTGTTAGAG. Insertion Sequence: GAATCAAGGCAGATTTGT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1947 C. elegans nuo-4(ok2533) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
K04G7.4. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2533 homozygotes (mid-larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: AAAACCCAAACGTGGCAATA. External right primer: TTGTTAAGACCATCATGCCG. Internal left primer: AAAAGTGTGCGTGGGGTAAT. Internal right primer: GTTCCATGAGCAAATTGGGA. Internal WT amplicon: 3154 bp. Deletion size: 1369 bp. Deletion left flank: TATGTCTTTCAGTATATCAAAATTAAAAAT. Deletion right flank: ATGAACAACTCCTCTGACTTGATTTGAGAG. Insertion Sequence: A. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1948 C. elegans R151.8(gk1047) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
R151.8. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP gk1047 homozygotes (sterile, does not lay eggs). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GGCGTGGTCTTCTTCTTCTG. External right primer: AGTTCTTCTCGACGACGCAT. Internal left primer: GAGATGCATGTCGTGTCGAT. Internal right primer: ATTGTTTCAGCACGGGAAAG. Internal WT amplicon: 2188 bp. Deletion size: 1135 bp. Deletion left flank: GGTTCTTCTCGGAATTATTGTAGTTTTTGG. Deletion right flank: GTAGAATCTCCTGCCAATGACCATTTTTTG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1955 C. elegans lin-12(ok2215) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
R107.8. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2215 homozygotes (sterile with vulval blip). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: AATCTTTTCTCGCAGCTCCA. External right primer: CATACATTTGCGTGTGTCCC. Internal left primer: GGGCTGTCATTCCGTTTCTA. Internal right primer: AAACCTGGGAACACATCGAC. Internal WT amplicon: 3327 bp. Deletion size: 1227 bp. Deletion left flank: ATTAATTCTGTTGGTGTGGTTTGGTTTTAT. Deletion right flank: GATTTCTAGAAAACAAACTGGTTGCTTGAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1961 C. elegans F26H9.8(ok2510) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
F26H9.8. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2510 homozygotes (probable early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CAAACATCCCATCCCGAATA. External right primer: CCATTTCACGAATTTCGGTC. Internal left primer: GTGACCCTTCGAAAAGTGGA. Internal right primer: TTTCAGTTTTTGGCACGTTTT. Internal WT amplicon: 1143 bp. Deletion size: 783 bp. Deletion left flank: CAAGTGGAGGTCATCCTCGATTTTGGCCGA. Deletion right flank: CAAAATTCTAAAAAATCGGCACTTGGAATT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1962 C. elegans pbs-6&cids-1(ok2516) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
C02F5.4, C02F5.9. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2516 homozygotes (early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: AATCGAAGCGGTACTTGTGG. External right primer: CTTTCCTGCATCAAGCATCA. Internal left primer: TTTCTTCAATTGGAGGACATCT. Internal right primer: ATTCCAGGAAGATCGAGCAA. Internal WT amplicon: 2526 bp. Deletion size: 1268 bp. Deletion left flank: GTGGTGAGGATGATGTTATCATTCCTGAAT. Deletion right flank: CGTTGAAGAAGCGAAAAAGAATGCACAAGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1966 C. elegans apm-1(ok2578) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
F55A12.7. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2578 homozygotes (probable early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: ACAGGGATGACTGTTTTGGC. External right primer: ATTACGGCTTCCACGTTTTG. Internal left primer: TGGCTTGAAGGATATTGGGA. Internal right primer: ACATGTCGATTTCCGGTCTC. Internal WT amplicon: 2261 bp. Deletion size: 1825 bp. Deletion left flank: TAAAGATAATATAGAAAAAAAAAATTTCGG. Deletion right flank: AAACTCACATTTCCTTTGAGGTCCAAGATG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1987 C. elegans F52C9.3(ok2530) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
F52C9.3. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2530 homozygotes (sterile with few eggs that don't hatch). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CCGGAGCAGTTGATACACAA. External right primer: TAGTTCCCTAAAACGTGGCG. Internal left primer: TTGGAACTGTTGTCACTGGC. Internal right primer: GGATGTTGGCAGGAAAATGT. Internal WT amplicon: 3134 bp. Deletion size: approximately 1000 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1994 C. elegans ncbp-2(ok2496) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
F26A3.2. Homozygous viable deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2496 homozygotes (probably viable Dpy, sometimes blistered, often sterile). Use care when maintaining - viable WT non-GFP animals are most likely rare recombinants. Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GGAAATTTTCACCTGCCTCA. External right primer: AAGGAATAAGGGGGTCATCG. Internal left primer: GCATGCAGCACTAATTTCCA. Internal right primer: TGTAGTCCAACATTGGCGAG. Internal WT amplicon: 2328 bp. Deletion size: 1024 bp. Deletion left flank: AAAAGTTGTTAAAACAAAAGGCTTACCTGG. Deletion right flank: GACAAAAGGATAAAGTCGACATTTTTCTGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1999 C. elegans eif-3.E(ok2607) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
B0511.10. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2607 homozygotes (early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TAATCTCCGTGTTTGCCACA. External right primer: GATGAGAAATCCCTGACCGA. Internal left primer: TCGCCTTGACTTTGTCTTGA. Internal right primer: GACTCCGTTGTTGCCATTTT. Internal WT amplicon: 1140 bp. Deletion size: 578 bp. Deletion left flank: GTTCAGCTTCCTCTTGGCTCATATTCAATC. Deletion right flank: CCATTCTTGGAGCAGAATTTCACTGGCCAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2005 C. elegans ZK973.9&lpd-5(ok2652) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
ZK973.10, ZK973.9. Homozygous lethal/sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2652 homozygotes (late larval arrest or sterile). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GGTTGAGGCTGTTGTTGGTT. External right primer: GAATCGGCGCTACTCATCTC. Internal left primer: GCAGCGGTACCATCATCTTT. Internal right primer: TTACAACGGGAGACAAAGGG. Internal WT amplicon: 2218 bp. Deletion size: 1384 bp. Deletion left flank: ACTCCTTTTTTGCAAAAAAAAACAAACAAA. Deletion right flank: TGCTTGTACGAGAACACATACCATTCCCTT. Insertion Sequence: T. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2018 C. elegans F16D3.4(ok2634) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
F16D3.4. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2634 homozygotes (mid-larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TGCGGGAGATTCAAATAAGG. External right primer: TTTTGCAGCAATGGATGAAG. Internal left primer: CAAAACGCGTCTCCATTTTT. Internal right primer: ATGCACCAGTCGATGAGTCG. Internal WT amplicon: 1161 bp. Deletion size: 464 bp. Deletion left flank: CCGTCAAAACTCTCCGATCAACGTGTTTGA. Deletion right flank: CGTACAATACACAAATCAGAAAGATATTTC. Insertion Sequence: CAAATACACAAATCAGAAAGATATTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2019 C. elegans B0336.3(gk910) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
B0336.3. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP gk910 homozygotes (early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GTACCCCATTGGTTCCTCCT. External right primer: TCAATTCCATCTCGAGGTCC. Internal left primer: ATTCTCGCATTTCTTTGCGT. Internal right primer: ATTTGGGCTGCAATCTCATC. Internal WT amplicon: 2166 bp. Deletion size: 408 bp. Deletion left flank: ATGGTTCCACTCCCGGCTACCGCTCCTAAT. Deletion right flank: CTTCAAGTTGCCAAGATTCCACCAGAGATG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2031 C. elegans R07E5.1(ok2653) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
R07E5.1. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2653 homozygotes (early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TCTTTTTGGGCCATTTTGAG. External right primer: CCATTTTCACAGCGGCTAAT. Internal left primer: AATTAATTTTTCCAGGCGGC. Internal right primer: CACAAATTTCGAAGCCATCA. Internal WT amplicon: 1186 bp. Deletion size: 399 bp. Deletion left flank: ATTTGCTAAAGTTTGAGTTTACGGGTTTTT. Deletion right flank: CTGTCTGGGAGTGGGAGTGGGAAAAGAAAG. Insertion Sequence: T. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2053 C. elegans wip-1(ok2435) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
R144.4. Homozygous sterile or near-sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2435 homozygotes (grotty, Unc, with vulval blip). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: AACGTATTCCGAAGTGCGAC. External right primer: CCATGAAGAAACCCAGGAAA. Internal left primer: TCAGAAAGATTGTTCCGGTTTT. Internal right primer: GGGGGATTGACGGACTATTT. Internal WT amplicon: 3053 bp. Deletion size: 1544 bp. Deletion left flank: AAATAAGACGGTAAAGAATTTTATCAGAAT. Deletion right flank: TCAGTTCCAAGCTCAAAACCGACTCCACCT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2100 C. elegans Y56A3A.2(ok2738) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Y56A3A.2. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2738 homozygotes (early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: ATTAAGCTCCGCCCATTTCT. External right primer: AACATCAATTTTGCCGGAAG. Internal left primer: GCTATTTCGCACTAAAATTGTTCA. Internal right primer: GAAGTTTCAATTCCGGCAAA. Internal WT amplicon: 1156 bp. Deletion size: 411 bp. Deletion left flank: ACGTTCGAATACACCTCCACCAGTCGGCAA. Deletion right flank: GTGCCAGAATTTGAATTTCCGGCAAATCGG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2105 C. elegans arx-5(ok1990) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Y37D8A.1. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok1990 homozygotes (late larval arrest or sterile adult). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GCTGGATTTTTCTGCGTCTC. External right primer: GGCCAATATGCTTTTCGTGT. Internal left primer: GATACCGTGGCGTTTTTGTT. Internal right primer: CGGGTCTCAACACGAAAAAT. Internal WT amplicon: 2347 bp. Deletion size: 879 bp. Deletion left flank: ATAGAGATTTCGCGTATTTCGCGCACAACA. Deletion right flank: AAAAATCTGTTTTCGGTAGGAATGTTCAAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2111 C. elegans rha-2(ok2639) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
C06E1.10. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2639 homozygotes (grotty sterile with vulval blip). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CTGCCAATGTTTTTCCGAGT. External right primer: TTCCACTTCGTTCCAAAACC. Internal left primer: CGTGATTCTTGCTTCCGTTT. Internal right primer: GTTATCAAAGTTGACGCCCG. Internal WT amplicon: 1103 bp. Deletion size: 558 bp. Deletion left flank: TCTGGAAATTAGCTTTTTTATTCTATAAAT. Deletion right flank: AGAATGGCACCCGGTGGTAGAGTTTCATGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2112 C. elegans Y71F9AL.17(ok2824) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Y71F9AL.17. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2824 homozygotes (embryonic or early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: ACTTTGACTTTTGCCCCCTT. External right primer: TCAGCAAGGATGTTGCTCTG. Internal left primer: AGCTGTCTGGAAATGTCCGT. Internal right primer: CTCCGTTACCCACAACCATT. Internal WT amplicon: 1146 bp. Deletion size: 766 bp. Deletion left flank: TGACAAGCTTATCCGTATTTCCAGTAACAA. Deletion right flank: AGCCGTGTTGATATTCTCGAGTTTGCGAAG. Insertion Sequence: GATACAAAAACGAGAGCTTCTCAAAGTTTTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2120 C. elegans W03G9.5(ok2325) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
W03G9.5. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2325 homozygotes (early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TCGTCTGCACATTTTTCTCG. External right primer: CCGTGAAATTCCCAGTGAAC. Internal left primer: GAAACTTGGAAAACCGCAAA. Internal right primer: GGATTTGCCGAAGATTCAAA. Internal WT amplicon: 2805 bp. Deletion size: 790 bp. Deletion left flank: ATTATTAATATTGAGCTCCCCCATGCCTGC. Deletion right flank: TTCCATTATTCCCGTCCTGAAAAAAAATGA. Insertion Sequence: TCTTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2164 C. elegans sdz-1&vps-33.1(ok2494) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
B0303.8, B0303.9. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2494 homozygotes (sterile). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CAGCCCTGGAAGACATTGAT. External right primer: AGTGAAACCATTGTCGGAGC. Internal left primer: ACCACCATACGGATCTCCAA. Internal right primer: CGGACTTTTTGGTTTCGATT. Internal WT amplicon: 2348 bp. Deletion size: 1060 bp. Deletion left flank: GAGTTTGGTATCCAGGTGTTGAAGTTTGAA. Deletion right flank: ACTGGGAAGGGACTGTTAGTTTTCTAAAAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2166 C. elegans nuo-4(ok2483) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
K04G7.4. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2483 homozygotes (early- to mid-larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: AAAACCCAAACGTGGCAATA. External right primer: TTGTTAAGACCATCATGCCG. Internal left primer: AAAAGTGTGCGTGGGGTAAT. Internal right primer: GTTCCATGAGCAAATTGGGA. Internal WT amplicon: 3154 bp. Deletion size: 1295 bp. Deletion left flank: TCTATTACTTAAAGCAAATTTTCAAATTGA. Deletion right flank: AGTCTAGAAACAATTATTTTGAAAGAAAAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2183 C. elegans ncbp-1(ok2787) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
F37E3.1. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2787 homozygotes (early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CGAAAAATATCGGGCTTCAA. External right primer: CCTTCCAATCTGTCCAGGTG. Internal left primer: GCCATCTATCTCCCAAATCG. Internal right primer: ATTAAACCCCCGCTAAATCG. Internal WT amplicon: 1121 bp. Deletion size: 534 bp. Deletion left flank: CTCAAAATCTTGCTATTTTCCTTTGTGATC. Deletion right flank: GCGGATTGTTCCGCCTTTTCTGTAAGTGCA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2189 C. elegans K10D2.4&cid-1(ok2757) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
K10D2.4, K10D2.3. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2757 homozygotes (early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: ACAACAACCGCGATCTTTTC. External right primer: CATCAATGGTTGTACAGCGG. Internal left primer: AAATCTCAGCGGGAGTTTGA. Internal right primer: CCGGCCTGTAAGTTCAATGT. Internal WT amplicon: 1136 bp. Deletion size: 713 bp. Deletion left flank: AGGCTGAAACAACCTTCATTTTACTTTTGC. Deletion right flank: AATGAAGTATATTAGGCCCTTCGTATTGCT. Insertion Sequence: AAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2199 C. elegans rab-5(ok2605) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
F26H9.6. Homozygous viable deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2605 homozygotes (early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GTTGCTGAAAACCGTCACAA. External right primer: GCTCATTCACTGGCTGAACA. Internal left primer: TTGCGTTGATTTCGAAGTTT. Internal right primer: TTCGAGGGGAAAACAATGAC. Internal WT amplicon: 1186 bp. Deletion size: 359 bp. Deletion left flank: GAAAGACGTAAAAACGTTAATAATTAAGAA. Deletion right flank: ATAAAAACATGTTAACAGAGTACTGAAATA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2216 C. elegans K10D2.4(ok2759) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
K10D2.4. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2759 homozygotes (sterile, no eggs). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: ACAACAACCGCGATCTTTTC. External right primer: CATCAATGGTTGTACAGCGG. Internal left primer: AAATCTCAGCGGGAGTTTGA. Internal right primer: CCGGCCTGTAAGTTCAATGT. Internal WT amplicon: 1136 bp. Deletion size: 658 bp. Deletion left flank: TTAAAATCTCAGCGGGAGTTTGATCAAATT. Deletion right flank: CATTGGGAAAGACGAACCGAATAATAGGTA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2223 C. elegans ZC434.7&ZC434.8(ok2797) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
ZC434.8, ZC434.7. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2797 homozygotes (grotty sterile). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TGCATCACATCGACACTTCC. External right primer: AAGGAGCTTCTGACTGCTCG. Internal left primer: GAATCGAGACGAGACGGAAT. Internal right primer: AGAAGCACTTGACAAAGGACG. Internal WT amplicon: 1371 bp. Deletion size: 991 bp. Deletion left flank: AGAAACATTAAACGTTATAAAGTTGAAGTT. Deletion right flank: AAAAAGTAATTACATTTTTCTCTCCCAAAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2224 C. elegans F46F11.11&ubl-5(ok2820) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
F46F11.4, F46F11.11. Homozygous viable deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2820 homozygotes (viable but sickly). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: AAAATCGGGACAGCTTCAGA. External right primer: CGCAAGTGTGAAACGCTATG. Internal left primer: AGCCATGATTTACAGGGTTCA. Internal right primer: TGCAGATTTTACCATACTTGCG. Internal WT amplicon: 3053 bp. Deletion size: 2291 bp. Deletion left flank: GTTACTGTACTTCTTTAAGGCGCACGCAAT. Deletion right flank: TCGACGCGCAAATGCAGACTTGCAATGTAA. Insertion Sequence: ACAATTGGAGATTTGAAATGTACGTAAAAACACACAAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2225 C. elegans npp-6(ok2821) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
F56A3.3. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2821 homozygotes (sterile with spiky vulva, no eggs). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TCGGCCAATATTCGAGTTTC. External right primer: CGTGTCAGTAGCGTCATCGT. Internal left primer: CATTGCTCAACGCAATCACT. Internal right primer: GCTCGATCGTCTGAAAAACA. Internal WT amplicon: 1360 bp. Deletion size: 549 bp. Deletion left flank: ATGATGAAGAAAGAGGGTGGTTACGGACCA. Deletion right flank: CAATCACTCAAGCTTATTCTCAGGACAACA. Insertion Sequence: TATGGCTATGATGAAATTCGAGAGTGGTTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807