jsIs37 [mec-7p::snb-1::GFP) + lin-15(+)]. snb-1::GFP expression in a subset of mechanosensory neurons; GFP is faint and can only be seen on a compound microscope. Heterozygotes are GFP+ in the pharynx. dhc-1 homozygotes are GFP- and sterile or partially sterile pvuls. Homozygous sterile mutation balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP js121 homozygotes. Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain.

Homozygous sterile mutation balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP tm1598 homozygotes (produce ~100% dead eggs, slightly higher penetrance at 25C). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Reference: Peters N, et al., J Cell Sci. 2010 Mar 1;123(Pt 5):795-805.

drSi13 [hsf-1p::hsf-1::GFP::unc-54 3'UTR + Cbr-unc-119(+)] II. Expresses single-copy drSi13 in the background of balanced hsf-1(ok600). drSi13 includes hsf-1 cDNA with a C-terminal GFP and controlled by 4 kb of the hsf-1 promoter, integrated at a single copy by MosSCI on chromosome II at ttTi5605. Segregates WT GFP+ heterozygotes, non-GFP rescued ok600; drSi13 homozygotes, very rare GFP+ homozygous hT2, and dead eggs. Maintain by picking wild-type GFP+. Reference: Morton EA, Lamitina T. Aging Cell. 2012 Oct 26. doi: 10.1111/acel.12024.

Segregates WT GFP+ heterozygotes, larval-arrested ok600 homozygotes, very rare GFP+ homozygous hT2, and dead eggs. Maintain by picking wild-type GFP+. [NOTE: Although ok600 has been reported as a 1085 bp deletion in hsf-1, sequencing of the hsf-1 PCR product revealed only an 877 bp deletion (5'-AAATAAAAATTTCTTAGAAA [877 bp deletion] TGTACATGGGATCCGGTCCA-3'). (Lamitina Lab, 12/17/2012)]

drSi28 [hsf-1p::hsf-1(R145A)::GFP::unc-54 3'UTR + Cbr-unc-119(+)] II. Expresses single-copy drSi28 in the background of balanced hsf-1(ok600). drSi28 includes hsf-1 cDNA containing an arginine to alanine mutation at residue 145 in the DNA binding domain with a C-terminal GFP and controlled by 4 kb of the hsf-1 promoter, integrated at a single copy by MosSCI on chromosome II at ttTi5605. Segregates WT GFP+ heterozygotes, non-GFP ok600 homozygotes (not rescued by drSi28), very rare GFP+ homozygous hT2, and dead eggs. Maintain by picking wild-type GFP+. Reference: Morton EA, Lamitina T. Aging Cell. 2012 Oct 26. doi: 10.1111/acel.12024.

Heterozygotes are WT and GFP+ in the pharynx. ot59 is homozygous inviable. qIs48 is an insertion of ccEx9747 (carries myo-2::GFP, pes-10::GFP, and a gut enhancer fused to GFP) onto the hT2 chromosome and is homozygous lethal. otIs3[lin-15(+) + gcy-7::GFP]. otIs3 is expressed in ASEL in WT animals. In this ot59 strain, otIs3 is expressed in ASEL and ASER.

otIs114 [lim-6p::GFP + rol-6(su1006)]. qIs48 [myo-2::GFP + pes-10::GFP + ges-1::GFP]. Homozygous hT2 animals are inviable. Heterozygotes are Rollers and GFP+. Homozygous lsy-22(ot244) otIs114 animals are Rollers and have a maternal effect embryonic lethal phenotype.

otIs3 [gcy-7::GFP + lin-15(+)]. qIs48 [myo-2::GFP + pes-10::GFP + ges-1::GFP]. Homozygous hT2 animals are inviable. Heterozygotes are WT and GFP+. Homozygous lsy-22(ot114) unc-101(m1) animals are Unc and have a maternal effect embryonic lethal phenotype. Whole genome sequenced strain.

otIs114 [lim-6p::GFP + rol-6(su1006)]. Rollers.

dcr-1 homozygotes are completely sterile. qIs48 is an insertion of ccEx9747 with markers: myo-2::GFP expressed brightly in the pharynx throughout development, pes-10::GFP expressed in embryos, and a gut promoter driving GFP in the intestine, and is homozygous lethal. Segregates WT glowing hets, non-glowing steriles , very rare homozygous hT2 glowing animals, and dead eggs. Do not distribute this strain; other labs should request it directly from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype.

nIs106 [lin-11::GFP + lin-15(+)] X. Homozygous maternal effect lethal ced-9 mutation balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ced-9 homozygotes (maternal effect lethal). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain.

Homozygous sterile mutation balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP sterile en671 homozygotes. Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain.

syIs187 [unc-119(+) + POPTOP]. Heterozygotes are WT and segregate WT and dead eggs. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.

Homozygous sterile CRISPR null mutant balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP+, arrested hT2 aneuploids, and non-GFP sy2071 homozygotes (L2 or early arrested sterile). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP+ and check for correct segregation of progeny to maintain. CRISPR/Cas9 engineered STOP-IN null mutant of npp-10. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CAATCAAAACAAAGGATTGTTTGGTCAGCCAGCC. Right flanking sequence: AATAACAGTGGAACTACTGGCCTTTTCGGGGCGGC. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: GTAGTTCCACTGTTATTGGC. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616.

Homozygous lethal deletion chromosome balanced by hT2. GFP+ heterozygotes are wild-type that segregate wild-type GFP+, arrested hT2 aneuploids, and non-GFP tm3309 homozygotes. tm3395 homozygotes are maternal effect lethal (late embryo & larval lethal) and have progeny with gonadogenesis defects. Pick wild-type GFP+ animals to maintain. Reference: Large EE and Mathies LD (2014 Jan 8). G3, doi: 10.1534/g3.113.009852.

Homozygous lethal deletion chromosome balanced by hT2. GFP+ heterozygotes are wild-type that segregate wild-type GFP+, arrested hT2 aneuploids, and non-GFP tm3309 homozygotes. tm3309 homozygotes are maternal effect lethal (late embryo & larval lethal) and have gonadogenesis defects. Previously known as swsn-2.1(tm3309). Pick wild-type GFP+ animals to maintain. Reference: Large EE and Mathies LD (2014 Jan 8). G3, doi: 10.1534/g3.113.009852.

Homozygous lethal deletion chromosome balanced by hT2. GFP+ heterozygotes are wild-type and segregate wild-type GFP+, arrested hT2 aneuploids, and non-GFP tm4795 homozygotes. tm4795 homozygotes arrest as early larvae. Pick wild-type GFP+ animals to maintain. Reference: Large EE and Mathies LD (2014 Jan 8). G3, doi: 10.1534/g3.113.009852.

Maintain at 15C. Pick fertile GFP+ hermaphrodites to maintain. Segregates WT GFP+ heterozygotes, non-glowing sterile gld-1 homozygotes, very rare GFP+ homozygous hT2, and dead eggs. fem-1 is temperature sensitive; causes feminization. gld-1 homozygotes form germline tumors. Reference: Biedermann et al., Dev Cell 17, 355-364 (2009).

F55F8.3 Heterozygotes are WT and GFP+. Segregates very rare homozygous hT2 glowing animals. qIs48 is an insertion of ccEx9747 (carries myo-2::GFP, pes-10::GFP, and a gut enhancer fused to GFP) onto the hT2 chromosome and is homozygous lethal. Outer Left Sequence: TACCAGTCAGAGTTGCCACG. Outer Right Sequence: GAATTGCGCCAATGAAGATT. Inner Left Sequence: TCAATTGCATTCCGTGATGT. Inner Right Sequence: GCGGAATTCGTGCTTTGTAT. Inner Primer PCR Length: 3397. Estimated Deletion Size: about 1300 bp. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T25G3.2 Heterozygotes are WT and GFP+. qIs48 is an insertion of ccEx9747 (carries myo-2::GFP, pes-10::GFP, and a gut enhancer fused to GFP) onto the hT2 chromosome and is homozygous lethal. Segregates very rare homozygous hT2 glowing animals. Outer Left Sequence: tgtggctgtgttgcaaagat. Outer Right Sequence: tggagaagcattccgagagt. Inner Left Sequence: atttgcacttcagctggctt. Inner Right Sequence: ggttcatcggtttcctcgta. Inner Primer PCR Length: 3205. Estimated Deletion Size: about 1600 bp. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C34G6.2 Heterozygotes are WT and GFP+. qIs48 is an insertion of ccEx9747 (carries myo-2::GFP, pes-10::GFP, and a gut enhancer fused to GFP) onto the hT2 chromosome and is homozygous lethal. Outer Left Sequence: agatgggatgatggagcaag. Outer Right Sequence: caagaggtccggatcaaaag. Inner Left Sequence: gctgaggttgcttaggttgc. Inner Right Sequence: atctccgaaatcgtcacgtc. Inner Primer PCR Length: 3245. Estimated Deletion Size: about 2250 bp. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C54G4.8 Heterozygotes are WT and GFP+. qIs48 is an insertion of ccEx9747 (carries myo-2::GFP, pes-10::GFP, and a gut enhancer fused to GFP) onto the hT2 chromosome and is homozygous lethal. Outer Left Sequence: ccgaagaattccgaatcaaa. Outer Right Sequence: tatcggcgcaagctactttt. Inner Left Sequence: tttggcgtcgaagaataacc. Inner Right Sequence: atgctgaggatcggattttg. Inner Primer PCR Length: 2598. Estimated Deletion Size: about 1600 bp. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F49D11.9 Heterozygotes are WT and GFP+. qIs48 is an insertion of ccEx9747 (carries myo-2::GFP, pes-10::GFP, and a gut enhancer fused to GFP) onto the hT2 chromosome and is homozygous lethal. Outer Left Sequence: aattgccaactgccgattat. Outer Right Sequence: tcggggagtacacaggctac. Inner Left Sequence: aagaacttcagagttgccgc. Inner Right Sequence: cgagctccataaaatcgcat. Inner Primer PCR Length: 2923. Estimated Deletion Size: about 900 bp. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

ZC395.2 Heterozygotes are WT and GFP+. Maintain by picking GFP+ worms. ok1247 animals are homozygous viable. qIs48 is an insertion of ccEx9747 (carries myo-2::GFP, pes-10::GFP, and a gut enhancer fused to GFP) onto the hT2 chromosome and is homozygous lethal. Outer Left Sequence: CGGGTTTCGCACTATTTTGT. Outer Right Sequence: CAGCTACCGTACCCGACATT. Inner Left Sequence: GCTGGCCCAGTACATTTGTT. Inner Right Sequence: CAGTGTTCCGGATTTCAGGT. Inner Primer PCR Length: . Estimated Deletion Size: about 1250 bp. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y110A7A.12 Heterozygotes are WT and GFP+. Maintain by picking GFP+ worms. ok1054 animals are homozygous viable. qIs48 is an insertion of ccEx9747 (carries myo-2::GFP, pes-10::GFP, and a gut enhancer fused to GFP) onto the hT2 chromosome and is homozygous lethal. Outer Left Sequence: GAAACACACAGGAACGGGAT. Outer Right Sequence: AATCGGCGTTTTTCAGAATG. Inner Left Sequence: TGGCAGAAGATGATCCAGTG. Inner Right Sequence: GCGTGGATCTCGATTACGAT. Inner Primer PCR Length: 2442. Estimated Deletion Size: about 1300 bp. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

B0025.2 Heterozygotes are WT and GFP+. Maintain by picking GFP+ worms. ok1288 is homozygous viable. qIs48 is an insertion of ccEx9747 (carries myo-2::GFP, pes-10::GFP, and a gut enhancer fused to GFP) onto the hT2 chromosome and is homozygous lethal. Outer Left Sequence: ttttatcgattttcccaccg. Outer Right Sequence: cctcgcccatttactggtta. Inner Left Sequence: agacccaggaaaagttcggt. Inner Right Sequence: accatcatccaaaattgcgt. Inner Primer PCR Length: 3177. Estimated Deletion Size: about 1800 bp. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C10H11.9 Heterozygotes are WT and GFP+. Maintain by picking GFP+ worms. qIs48 is an insertion of ccEx9747 (carries myo-2::GFP, pes-10::GFP, and a gut enhancer fused to GFP) onto the hT2 chromosome and is homozygous lethal. Outer Left Sequence: tcaatgaagcgtcgaagttg. Outer Right Sequence: gatcgagataatgcgggaga. Inner Left Sequence: cgagttcacgagagagaccc. Inner Right Sequence: gccgaagacatttaacggaa. Inner Primer PCR Length: 3323. Estimated Deletion Size: about 1800 bp. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F58D5.1 Heterozygous. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are wild-type with pharyngeal GFP signal, and segregate wild-type GFP+, arrested hT2 aneuploids, and non-GFP ok1278 homozygotes (larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. NOTE: (04/2019) RB1333 was originally described as a homozygous strain carrying an unknown GFP transgene in the background. It was recently reported by a user that the strain is heterozygous for ok1278. Their characterization of the strain found that the deletion is balanced by a GFP-marked balancer, most likely hT2[qIs48], though the identity of the balancer has not been molecularly confirmed. Outer Left Sequence: tccaaatcctgaaaatccca. Outer Right Sequence: cagatcccagttttgcgaat. Inner Left Sequence: ttgtgtgtgcgtccaatttt. Inner Right Sequence: acattccaacggacgtcttc. Inner Primer PCR Length: 3310. Estimated Deletion Size: about 1700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

umnIs73 [myo-2p::mKate2 + NeoR, III: 9421936 (intergenic)] I. Homozygous Lvl. Deletion of 477 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain PD1074. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 dead larvae (ve568 homozygotes), non-GFP mKate2+ arrested animals (arrest stage unknown)(hT2 homozygotes) and dead eggs (aneuploids). Pick wild-type GFP+ mKate2+ and check for correct segregation of progeny to maintain. [NOTE: Apparently the lethal mutation is closely linked but not within the balanced region of hT2. It can occasionally recombine away so that the strain will segregate Bli-4 hT2 homozygotes. (Mark Edgley)] Left flanking Sequence: TTTCACCCCCAATAAACCTATCAATTATCA ; Right flanking sequence: tcaggtttaaattagatttcttcgaatttg. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs73 [myo-2p::mKate2 + NeoR, III: 9421936 (intergenic)] I. Homozygous larval arrest. Deletion of 616 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 arrested larvae (ve585 homozygotes), non-GFP mKate2+ arrested animals (arrest stage unknown)(hT2 homozygotes) and dead eggs (aneuploids). Pick wild-type GFP+ mKate2+ and check for correct segregation of progeny to maintain. [NOTE: Apparently the lethal mutation is closely linked but not within the balanced region of hT2. It can occasionally recombine away so that the strain will segregate Bli-4 hT2 homozygotes. (Mark Edgley)] Left flanking Sequence: ttatcaaactctcatttttagATGCCATCG ; Right flanking sequence: GTCGGCGACGGAATATATTCTTCAAAATCC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs73 [myo-2p::mKate2 + NeoR, III: 9421936 (intergenic)] I. ZK858.7. Homozygous lethal. Deletion of 2453 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 lethals(lethal mid-larval to adult) (ve739 homozygotes), non-GFP mKate2+ arrested animals (arrest stage unknown)(hT2 homozygotes) and dead eggs (aneuploids). Pick wild-type GFP+ mKate2+ and check for correct segregation of progeny to maintain. [NOTE: Apparently the lethal mutation in hT2 is closely linked but not within the balanced region of hT2. It can occasionally recombine away so that the strain will segregate Bli-4 hT2 homozygotes. (Mark Edgley)] Left flanking Sequence: catattattaaattttaagtgtaaaagatt ; Right flanking sequence: aggcaacagagaacgaacgataaagtagtc. sgRNA #1: gaggaaatatgcaatttact; sgRNA #2: atcgacgagacggctacgaa. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs73 [myo-2p::mKate2 + NeoR, III: 9421936 (intergenic)] I. Homozygous larval arrest. Deletion of 1689 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 arrested larvae (ve763 homozygotes), non-GFP mKate2+ arrested animals (arrest stage unknown)(hT2 homozygotes) and dead eggs (aneuploids). Pick wild-type GFP+ mKate2+ and check for correct segregation of progeny to maintain. [NOTE: Apparently the lethal mutation is closely linked but not within the balanced region of hT2. It can occasionally recombine away so that the strain will segregate Bli-4 hT2 homozygotes. (Mark Edgley)] Left flanking Sequence: gaaatcagtgatcaggcaacagacaacagc ; Right flanking sequence: cggaaatcgcgatggcgaagcacacaaaaa. sgRNA #1: tgatgtgaaccagagaaagc; sgRNA #2: ggtaaaagtctgcggaatga. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs73 [myo-2p::mKate2 + NeoR, III: 9421936 (intergenic)] I. Homozygous sterile. Deletion of 2540 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 sterile adults (ve769 homozygotes), non-GFP mKate2+ arrested animals (arrest stage unknown)(hT2 homozygotes) and dead eggs (aneuploids). Pick wild-type GFP+ mKate2+ and check for correct segregation of progeny to maintain. [NOTE: Apparently the lethal mutation is closely linked but not within the balanced region of hT2. It can occasionally recombine away so that the strain will segregate Bli-4 hT2 homozygotes. (Mark Edgley)] Left flanking Sequence: atgaaattaaaaataaataaaaattttgag ; Right flanking sequence: ATTTGTAATTCATTTGGATTCGGTGCCACA. sgRNA #1: ATGCACCGTGTTGTTATAAC; sgRNA #2: TGAGATTCGCGATTTATTTC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous early larval lethal. Deletion of 2440 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 dead larvae (ve784 homozygotes), non-GFP mKate2+ arrested animals (arrest stage unknown)(hT2 homozygotes) and dead eggs (aneuploids). Pick wild-type GFP+ mKate2+ and check for correct segregation of progeny to maintain. [NOTE: Apparently the lethal mutation is closely linked but not within the balanced region of hT2. It can occasionally recombine away so that the strain will segregate Bli-4 hT2 homozygotes. (Mark Edgley)] Left flanking Sequence: CTTCTGCTGAGCATACGACGACGCATTTCG ; Right flanking sequence: ttaaataataatttattatttaatcacaat. sgRNA #1: AATTCGCAACTAGCCATGTG; sgRNA #2: atctccgcgcaaatgcccac. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs73 [myo-2p::mKate2 + NeoR, III: 9421936 (intergenic)] I. Homozygous larval arrest, Mlt. Deletion of 15775 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 arrested larvae (ve816 homozygotes), non-GFP mKate2+ arrested animals (arrest stage unknown)(hT2 homozygotes) and dead eggs (aneuploids). Pick wild-type GFP+ mKate2+ and check for correct segregation of progeny to maintain. [NOTE: Apparently the lethal mutation is closely linked but not within the balanced region of hT2. It can occasionally recombine away so that the strain will segregate Bli-4 hT2 homozygotes. (Mark Edgley)] Left flanking Sequence: CTTGGTTGTCAAGCAGGTTGCCATCCATCA ; Right flanking sequence: CACGTCAGCATCTGCAATGTCACCAAACAG. sgRNA #1: CACGTACATTCACCTCCATG; sgRNA #2: GATGGCTGATCATTTGATGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs73 [myo-2p::mKate2 + NeoR, III: 9421936 (intergenic)] I. Homozygous larval arrest. Deletion of 5392 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 arrested larvae, some larva mature into sterile dumpyish adults (ve863 homozygotes), non-GFP mKate2+ arrested animals (arrest stage unknown)(hT2 homozygotes) and dead eggs (aneuploids). Pick wild-type GFP+ mKate2+ and check for correct segregation of progeny to maintain. [NOTE: Apparently the lethal mutation is closely linked but not within the balanced region of hT2. It can occasionally recombine away so that the strain will segregate Bli-4 hT2 homozygotes. (Mark Edgley)] Left flanking Sequence: AAGTATTCGGCTGGGCCTCCGCGGcgcatc; Right flanking sequence: CTAACTTTGGACCAATGTATATTTGCAAAC. nsun-4 sgRNA #1: AATATCGATTCGGAGACAGA; nsun-4 sgRNA #2: AGGGTAGAAACGGCACGACG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs73 [myo-2p::mKate2 + NeoR, III: 9421936 (intergenic)] I. Homozygous Mel. Deletion of 1641 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 adults that give dead eggs (ve885 homozygotes), non-GFP mKate2+ arrested animals (arrest stage unknown)(hT2 homozygotes) and dead eggs (aneuploids). Pick wild-type GFP+ mKate2+ and check for correct segregation of progeny to maintain. [NOTE: Apparently the lethal mutation is closely linked but not within the balanced region of hT2. It can occasionally recombine away so that the strain will segregate Bli-4 hT2 homozygotes. (Mark Edgley)] Left flanking Sequence: TGGAGGGAGAAGATTGAGCTCATAGTGGAG; Right flanking sequence: TGGCAATTCTTAAACATCCAAATGCAATTG. plag-15 sgRNA A: CCTCCATCATCATACCCGAC; plag-15 sgRNA B: AGTATTTCAAGCTGATCACA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs73 [myo-2p::mKate2 + NeoR, III: 9421936 (intergenic)] I. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced over mKate2 tagged hT2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (gk5666 homozygotes), lethal non-GFP mKate2+ hT2 homozygotes (arrest stage unknown) and dead eggs (aneuploids). Derived from parental strains VC4596 and CGC92. gk5666 is a 2234 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: GGTGGGCGGCAAAATATTTTTTCCGCCAAACCGGCAAATTGCCGGAATTGAAAATTTCCG. Right flanking sequence: TTCGGAAGTTAAGTGGCATTTGAAGCCGTT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs73 [myo-2p::mKate2 + NeoR, III: 9421936 (intergenic)] I. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced over mKate2 tagged hT2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (gk5471 homozygotes), lethal non-GFP mKate2+ hT2 homozygotes (arrest stage unknown) and dead eggs (aneuploids). Derived from parental strains VC4393 and CGC92. gk5471 is a 3877 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: GAAATATTCGAACTTCTCGATGGTCCACCA; Right flanking sequence: ATAGAAAACAGGATTTGATGTTGAAAATTT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs73 [myo-2p::mKate2 + NeoR, III: 9421936 (intergenic)] I. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced over mKate2 tagged hT2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (gk5478 homozygotes), lethal non-GFP mKate2+ hT2 homozygotes (arrest stage unknown) and dead eggs (aneuploids). Derived from parental strains VC4400 and CGC92. gk5478 is a 2626 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TTTTTTACCTATTGCTTTTGCTCTGTAGTA; Right flanking sequence: GACGGTGTTGCTGCTGGGCTGCTGCTCAAT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs73 [myo-2p::mKate2 + NeoR, III: 9421936 (intergenic)] I. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced over mKate2 tagged hT2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (gk5481 homozygotes), lethal non-GFP mKate2+ hT2 homozygotes (arrest stage unknown) and dead eggs (aneuploids). Derived from parental strains VC4403 and CGC92. [NOTE: RG5020 and the parental strain VC4403 exhibit weak red fluorescence. The cause of this fluorescence is unknown, but gk5481 is a clean deletion/insertion confirmed by PCR.] gk5481 is a 2871 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TTGCTTTCAGGCAATCGTCACGCTCGTTGA; Right flanking sequence: GGCGGGAGATCTGCAAAAATCGATAATCTA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs73 [myo-2p::mKate2 + NeoR, III: 9421936 (intergenic)] I. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced over mKate2 tagged hT2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (gk5510 homozygotes), lethal non-GFP mKate2+ hT2 homozygotes (arrest stage unknown) and dead eggs (aneuploids). Derived from parental strains VC4435 and CGC92. gk5510 is a 735 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TAAAACCGCTCCAGCGCGGTACATTTCTGT; Right flanking sequence: GTAAAATAGAGATTTTCCATGGAGCGCACT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs73 [myo-2p::mKate2 + NeoR, III: 9421936 (intergenic)] I. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced over mKate2 tagged hT2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (gk5610 homozygotes), lethal non-GFP mKate2+ hT2 homozygotes (arrest stage unknown) and dead eggs (aneuploids). Derived from parental strains VC4539 and CGC92. gk5610 is a 433 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: AGCTACTCAGCACGTGCCTATTATCCTCAC; Right flanking sequence: GCTGGTTTGGGAGTGGCGCCGCATGTTGCG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs73 [myo-2p::mKate2 + NeoR, III: 9421936 (intergenic)] I. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced over mKate2 tagged hT2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (gk5549 homozygotes), lethal non-GFP mKate2+ hT2 homozygotes (arrest stage unknown) and dead eggs (aneuploids). Derived from parental strains VC4477 and CGC92. gk5549 is a 1227 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TGTTTTGAACGCTCGCGCCACAATGTCATA; Right flanking sequence: ATTTTCCCTTGTTCTCTTGCTCACAGTAAT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs73 [myo-2p::mKate2 + NeoR, III: 9421936 (intergenic)] I. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced over mKate2 tagged hT2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (gk5632 homozygotes), lethal non-GFP mKate2+ hT2 homozygotes (arrest stage unknown) and dead eggs (aneuploids). Derived from parental strains VC4561 and CGC92. gk5632 is a 1065 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: ACATCAAAGTCAGAGTTTTATGGCTCACCG; Right flanking sequence: GGGGCTTGTAAGATGAGAAGCACCCGTTCT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs73 [myo-2p::mKate2 + NeoR, III: 9421936 (intergenic)] I. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced over mKate2 tagged hT2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (gk5646 homozygotes), lethal non-GFP mKate2+ hT2 homozygotes (arrest stage unknown) and dead eggs (aneuploids). Derived from parental strains VC4575 and CGC92. gk5646 is a 1524 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: CAAAAAAACTGGATAACAATAAATTGGCAA; Right flanking sequence: TGGAAAACGCACGCGACGCGTGACCGCAGC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs73 [myo-2p::mKate2 + NeoR, III: 9421936 (intergenic)] I. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced over mKate2 tagged hT2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (gk5373 homozygotes), lethal non-GFP mKate2+ hT2 homozygotes (arrest stage unknown) and dead eggs (aneuploids). Derived from parental strains VC4290 and CGC92. gk5373 is a 1874 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: ATTGGCCAGCAGCATCAGCACGCACCCGGG; Right flanking sequence: TGTCTTGGCGGTGCTGGAACAGCAAAATTG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs73 [myo-2p::mKate2 + NeoR, III: 9421936 (intergenic)] I. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced over mKate2 tagged hT2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (gk5705 homozygotes), lethal non-GFP mKate2+ hT2 homozygotes (arrest stage unknown) and dead eggs (aneuploids). Derived from parental strains VC4636 and CGC92. gk5705 is a 737 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: AAACATGGAGATACTGAAACGCATCCTGCA; Right flanking sequence: TCAGCTGAACGGAAATTCAAACCTTGTAAC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs73 [myo-2p::mKate2 + NeoR, III: 9421936 (intergenic)] I. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced over mKate2 tagged hT2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (gk5836 homozygotes), lethal non-GFP mKate2+ hT2 homozygotes (arrest stage unknown) and dead eggs (aneuploids). Derived from parental strains VC4768 and CGC92. gk5836 is a 1235 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: CTCCATTCTTGATATGCAATGTTTTTTAAA; Right flanking sequence: TGGGCTAAGAGTTCCGATGCACCCTCGGTG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs73 [myo-2p::mKate2 + NeoR, III: 9421936 (intergenic)] I. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced over mKate2 tagged hT2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (gk5733 homozygotes), lethal non-GFP mKate2+ hT2 homozygotes (arrest stage unknown) and dead eggs (aneuploids). Derived from parental strains VC4664 and CGC92. gk5733 is a 957 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TGAACCAAACAATCATCAGCATATGTTCCT; Right flanking sequence: AATATCAGAAAAAATTTTTGCGAAAAAGTC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.