More Fields
Strain Species Genotype
KR652 C. elegans let-588(h318) dpy-5(e61) unc-13(e450) I; sDp2 (I;f). Show Description
Animals with the duplication are Unc. Animals which have lost the duplication are DpyUnc and arrest as Sterile Adults.
JH3180 C. elegans nos-2(ax2033) II. Show Description
Maintain at 20C. ax2033 was produced by replacing +16 to +42 with TCGACTCTCGAACGATCGTAATAG in the first exon of nos-2. ax2033 mutants are sterile when fed nos-1 dsRNA. Reference: Paix A, et al. Genetics. 2014 Sep 23.
JH3182 C. elegans gtbp-1(ax2035[gtbp-1::TetraCys]) IV. Show Description
Maintain at 20-25C. ax2035 was produced by mutation of the sgRNA site and insertion of TetraCys tag at the C-terminus of gtbp-1. Substitution/insertion of the sequence GCAGCATCCTGGGCAGCAATTTTGTCCGGCATTTTGGAAACCGCTGCGCATTCCTCCAC GT between IV: 10127239...10127283. Reference: Paix A, et al. Genetics. 2014 Sep 23.
JH3184 C. elegans gtbp-1(ax2037([gtbp-1::Myc]) IV. Show Description
Maintain at 20-25C. ax2037 was produced by mutation of the sgRNA site and insertion of Myc tag at the C-terminus of gtbp-1. Substitution/insertion of the sequence CAGATCCTCTTCTGATATCAGTTTTTGTTCATTTTGTCCCGCATTTTGGAAACCGCTAC GCATTCCTCCACGC between IV: 10127239...10127283. Reference: Paix A, et al. Genetics. 2014 Sep 23.
JH3186 C. elegans gtbp-1(ax2039[gtbp-1::3xFlag]) IV. Show Description
Maintain at 20-25C. ax2039 was produced by insertion of 3xFLAG tag at the C-terminus of gtbp-1 by NHEJ. Substitution/insertion of the sequence CTTGTCATCGTCATCCTTGTAATCGATATCATGATCTTTATAATCACCGTCATGGTCTT TGTAGTCCTCCACGAGGAATGCGTGAGGAAATCGTGGA between IV: 10127239...10127269. Reference: Paix A, et al. Genetics. 2014 Sep 23.
JH3188 C. elegans mex-5(ax2041[3xFLAG::mex-5]) IV. Show Description
Maintain at 20C. 3xFLAG-tagged MEX-5. Reference: Paix A, et al. Genetics. 2014 Sep 23.