More Fields
Strain Species Genotype
JH2434 C. elegans unc-119(ed3) III; axIs1758. Show Description
axIs1758 [spn-4p::GFP::histone H2B:tbb-2 3'utr + unc-119(+)]. Transgene is slightly unstable. Pick non-Unc, GFP+ worms to maintain.
JH2435 C. elegans unc-119(ed3) III; axIs1759. Show Description
axIs1759 [msp-56p::GFP::histone H2B:tbb-2 3'utr + unc-119(+)].
JH2436 C. elegans unc-119(ed3) III; axIs1723. Show Description
axIs1723 [pie-1p::GFP::histone H2B:gld-1 3'utr + unc-119(+)]. Transgene is prone to silencing -- maintain at 25C.
JH2464 C. elegans unc-119(ed3) III; axIs1779. Show Description
axIs1779 [pie-1p::mCherry::H2B::tbb-2 3'UTR + unc-119(+)]. Maintain at 25C to maintain transgene expression.
JH2471 C. elegans unc-119(ed3) III; axIs1775. Show Description
axIs1775 [pie-1p::GFP::histone H2B:gld-1 M1M2 3'utr + unc-119(+)]. Transgene is prone to silencing -- maintain at 25C. Pick wild-type worms to maintain.
JH2513 C. elegans fbf-1(ok91) II; axIs1723. Show Description
axIs1723 [pie-1p::GFP::H2B::gld-1 3'UTR + unc-119(+)]. Maintain at 25C to maintain transgene expression. Unknown if ed3 is still in background.
JH2523 C. elegans fbf-2(q738) II; axIs1722. Show Description
axIs1722 [pie-1p::GFP::H2B::fog-1 3'UTR + unc-119(+)]. Maintain at 25C to maintain transgene expression. Unknown if ed3 is still in background.
JH2525 C. elegans fbf-1(ok91) II; axIs1722. Show Description
axIs1722 [pie-1p::GFP::H2B::fog-1 3'UTR + unc-119(+)]. Maintain at 25C to maintain transgene expression. Unknown if ed3 is still in background.
JH2621 C. elegans unc-119(ed3) III; axIs1849. Show Description
axIs1849 [pie-1p::GFP::H2B::htp-3 3'UTR + unc-119(+)]. Maintain at 25C to maintain transgene expression. GFP expression in adult germline; somatic and germline expression in embryos.
JH2623 C. elegans unc-119(ed3) III; axIs1851. Show Description
axIs1851 [pie-1p::GFP::H2B::rad-51 3'UTR + unc-119(+)]. Maintain at 25C to maintain transgene expression. GFP expression in adult germline; somatic and germline expression in embryos.
JH2671 C. elegans unc-119(ed3) III; axIs1864. Show Description
axIs1864 [pie-1p::GFP::H2B::zim-1 3'UTR + unc-119(+)]. Maintain at 25C to maintain transgene expression. GFP expression in mitotic germline; variable, sometimes weak, GFP expression in pachytene stage.
JH2704 C. elegans unc-119(ed3) III; axIs1890. Show Description
axIs1890 [pie-1p::GFP::H2B::msh-5 3'UTR + unc-119(+)]. Maintain at 25C to maintain transgene expression. Weak GFP expression in mitotic germline; GFP expression in pachytene, oocytes, and embryos.
JH2730 C. elegans unc-119(ed3) III; axIs1895. Show Description
axIs1895 [pie-1p::GFP::H2B::rec-8 3'UTR + unc-119(+)]. Maintain at 25C to maintain transgene expression. GFP expression in adult germline; somatic and germline expression in embryos.
JH2791 C. elegans pptr-1(tm3103) V; axIs1448. Show Description
axIs1448 [pie-1p::GFP::H2B::nos-2(wt) 3'UTR + unc-119(+)]. Transgene is prone to silencing -- maintain at 25C.Reference: Gallo CM, et al. Science. 2010 Dec 17;330(6011):1685-9.
JH2877 C. elegans fbf-2(q738) II; pgl-1(ct131) him-3(e1147) III; axIs1722. Show Description
axIs1722 [pie-1p::GFP::H2B::fog-1 3'UTR + unc-119(+)]. Maintain at 25C to maintain transgene expression. Unknown if ed3 is still in background.
JH2883 C. elegans fbf-1(ok91) II; pgl-1(ct131) him-3(e1147) III; axIs1722. Show Description
axIs1722 [pie-1p::GFP::H2B::fog-1 3'UTR + unc-119(+)]. Maintain at 25C to maintain transgene expression. Unknown if ed3 is still in background.
JIM113 C. elegans ujIs113 II. Show Description
ujIs113 [pie-1p::mCherry::H2B::pie-1 3'UTR + nhr-2p::his-24::mCherry::let-858 3'UTR + unc-119(+)]. Reference: Zacharias A, et al. PLoS Genet. 2015 Oct 21;11(10):e1005585.
JIM193 C. elegans ujIs113 II; ujIs193. Show Description
ujIs113 [pie-1p::mCherry::H2B::pie-1 3'UTR + nhr-2p::his-24::mCherry::let-858 3'UTR + unc-119(+)] II. ujIs193 [nhr-67::TY1::EGFP::3xFLAG + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence in fosmid ID#WRM0633cC01 by recombineering. Expression of transgene confirmed by GFP.
JIM220 C. elegans ujIs113 II; unc-30(ok613) IV; ceh-36(ok795) X; ujEx173. Show Description
ujIs113 [pie-1p::mCherry::H2B::pie-1 3'UTR + nhr-2p::his-24::mCherry::let-858 3'UTR + unc-119(+)] II. ujEx173 [ceh-36::TY1::eGFP::3xFLAG + unc-119(+)]. ujEx173 rescues unc-36, suppressing synthetic lethality in animals carrying the array. Reference: Walton T, et al. PLoS Genet. 2015 Mar 4;11(3):e1005003.
JIM271 C. elegans ujIs113 II; stIs10286. Show Description
ujIs113 [pie-1p::mCherry::H2B::pie-1 3'UTR + nhr-2p::his-24::mCherry::let-858 3'UTR + unc-119(+)]. stIs10286 [nob-1::GFP::unc-54 3'UTR + rol-6(su1006)]. stIs10286 contains 9kb promoter and full nob-1 transcript fused to GFP. Reference: Zhao Z, et al. PLoS Genet. 2010 Sep 2;6(9):e1001089.
JIM356 C. elegans ujIs113 II; ujIs153. Show Description
ujIs113 [pie-1p::mCherry::H2B::pie-1 3'UTR + nhr-2p::his-24::mCherry::let-858 3'UTR + unc-119(+)] II. ujIs153 [ceh-13::TY1::EGFP::3xFLAG + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence in fosmid ID#WRM0622c06 by recombineering. Expression of transgene confirmed by GFP.
JK4842 C. elegans qSi29 II; unc-119(ed3) III. Show Description
qSi29 [sygl-1p(LBSmut)::H2B::GFP::sygl-1 3'end + unc-119(+)]. Superficially wild-type. Expression of H2B::GFP in the loop region of the germline. qSi29 contains 2kb upstream of the sygl-1 start with the four LAG-1 binding sites (LBS) mutated (RTGRGAA->RacRGAA) driving H2B::GFP under the control of the sygl-1 3' intergenic region. Reference: Kerschner AM, et al. Proc Natl Acad Sci U S A. 2014 Mar 11;111(10):3739-44.
JK5018 C. elegans qSi26 II; unc-119(ed3) III; teIs1 IV. Show Description
qSi26 [sygl-1p::H2B::GFP::sygl-1 3' end + unc-119(+)]. GFP expression in distal germ cell nuclei. teIs1 [oma-1::GFP + unc-119(+)]. oma-1::GFP expression in oocyte cytoplasm. teIs1 rescues GFP expression in silenced germline trangenes more effectively at 25C. Reference: Kerschner AM, et al. Proc Natl Acad Sci U S A. 2014 Mar 11;111(10):3739-44.
JK5072 C. elegans qSi29 II; unc-119(ed3) III; teIs1 IV. Show Description
qSi29 [sygl-1p(LBSmut)::H2B::GFP::sygl-1 3'end + unc-119(+)]. teIs1 [oma-1::GFP + unc-119(+)]. Superficially wild-type. Expression of H2B::GFP in the loop region of the germline. qSi29 contains 2kb upstream of the sygl-1 start with the four LAG-1 binding sites (LBS) mutated (RTGRGAA->RacRGAA) driving H2B::GFP under the control of the sygl-1 3' intergenic region. oma-1::GFP expression in oocyte cytoplasm. teIs1 rescues GFP expression in silenced germline trangenes more effectively at 25C. Reference: Kerschner AM, et al. Proc Natl Acad Sci U S A. 2014 Mar 11;111(10):3739-44.
JK5896 C. elegans qSi369 II; unc-119(ed3) III; qSi370 V. Show Description
qSi369 [sygl-1p::24xMS2 loops::3xflag::sygl-1::sygl1 3'UTR]. qSi370 [mex-5p:: MS2 Coat Protein::linker::sfGFP::tbb-2 3' UTR::gpd-2 intergenic sequence::H2B::mCherry::unc-54 3' UTR]. Superficially wild-type with expression of sfGFP and nuclear mCherry in germline. qSi369 and qSi370 constitute an MS2 system which allows live visualization of sygl-1 nascent transcripts in the C. elegans germline in a glp-1 mutant background. qSi370 can be prone to silencing, especially after severe starvation; silencing of GFP or mCherry expression can occur independently of one another. Maintain by picking animals with bright GFP and mCherry expression. Reference: Lee C, et al. Dev Cell. 2019 Aug 19;50(4):426-435.e4.
JK5932 C. elegans sygl-1(q828) I; qSi369 II; qSi370 V. Show Description
qSi369 [sygl-1p::24xMS2 loops::3xflag::sygl-1::sygl1 3'UTR]. qSi370 [mex-5p:: MS2 Coat Protein::linker::sfGFP::tbb-2 3' UTR::gpd-2 intergenic sequence::H2B::mCherry::unc-54 3' UTR]. Superfically wild-type with expression of sfGFP and nuclear mCherry in germline. qSi369 and qSi370 constitute an MS2 system which allows live visualization of sygl-1 nascent transcripts in the C. elegans germline in a glp-1 mutant background. Reference: Lee C, et al. Dev Cell. 2019 Aug 19;50(4):426-435.e4.
JK5943 C. elegans qSi369 II; glp-1(q224) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III); qSi370 V. Show Description
qSi369 [sygl-1p::24xMS2 loops::3xflag::sygl-1::sygl1 3'UTR]. qSi370 [mex-5p:: MS2 Coat Protein::linker::sfGFP::tbb-2 3' UTR::gpd-2 intergenic sequence::H2B::mCherry::unc-54 3' UTR]. Heterozygotes are wild-type with pharyngeal GFP signal, and segregate wild-type GFP+ heterozygotes, non-GFP pharynx q224 homozygotes (Glp sterile at 20-25C) and dead eggs (hT2 homozygotes). All animals are sfGFP + in the germline, with distal and proximal transcription sites in the nucleus. qSi369 and qSi370 constitute an MS2 system which allows live visualization of sygl-1 nascent transcripts in the C. elegans germline in a glp-1 mutant background. Reference: Lee C, et al. Dev Cell. 2019 Aug 19;50(4):426-435.e4.
JK6690 C. elegans qSi422 [*rajSi50] II. Show Description
qSi422 [*rajSi50 (gld-1p::GFP::H2B::gld-1 3'UTR [FBEa TGT to ACA] + Cbr-unc-119(+))] II. Maintain at 24C on OP50. Select well-fed adult animals with bright germline GFP in nuclei to propagate strain. Engineered TGT to ACA substitution in FBEa in rajSi50 gld-1 3’UTR reporter and substitution of downstream G to C to disrupt PAM site. GFP is visible in germline nuclei. Kimble lab crossed original NIK50 strain with TX189 [oma-1::GFP] and back out again to reduce GFP silencing. Primers to confirm FBEa mutation: slc314 GTCACCAAGTACACTTCCAGCAAG / prHJS401 TGGCAACATGATGTATCGCTGT (~100 bp band in mutant, no product in wild-type). Reference: Carrick BH, et al. Dev Cell. 2024. "PUF partner interactions at a conserved interface shape the RNA-binding landscape and cell fate in Caenorhabditis elegans."
JK6692 C. elegans qSi424 [*rajSi50] II. Show Description
qSi424 [*rajSi50 (gld-1p::GFP::H2B::gld-1 3'UTR [FBEb TGT to ACA] + Cbr-unc-119(+))] II. Maintain at 24C on OP50. Select well-fed adult animals with bright germline GFP in nuclei to propagate strain. Engineered TGT to ACA substitution in FBEb in rajSi50 gld-1 3’UTR reporter and GFP is visible in germline nuclei. Kimble lab crossed original NIK50 strain with TX189 [oma-1::GFP] and back out again to reduce GFP silencing. Primers to confirm FBEb mutation: slc314 GTCACCAAGTACACTTCCAGCAAG / slc302 GGGTTAGCGTTAAGATAACTGT (~500 bp band in FBEb mutant, no product in wild-type). Reference: Carrick BH, et al. Dev Cell. 2024. "PUF partner interactions at a conserved interface shape the RNA-binding landscape and cell fate in Caenorhabditis elegans."
JK6693 C. elegans qSi425 [*rajSi50] II. Show Description
qSi425 [*rajSi50 (gld-1p::GFP::H2B::gld-1 3'UTR [FBEa TGT to ACA] [FBEb TGT to ACA] + Cbr-unc-119(+))] II. Maintain at 24C on OP50. Select well-fed adult animals with bright germline GFP in nuclei to propagate strain. qSi425 contains engineered TGT to ACA substitution in FBEa in rajSi50 gld-1 3’UTR reporter and substitution of downstream G to C to disrupt PAM site, and TGT to ACA substitution in FBEb in rajSi50 gld-1 3’UTR reporter. GFP is visible in germline nuclei. Derived by targeted modification of FBEb in parental strain JK6690. Kimble lab crossed original NIK50 strain with TX189 [oma-1::GFP] and back out again to reduce GFP silencing. Primers to confirm FBEa mutation: slc314 GTCACCAAGTACACTTCCAGCAAG / prHJS401 TGGCAACATGATGTATCGCTGT (~100 bp band in FBEa mutant, no product in wild-type). Primers to confirm FBEb mutation: slc314 GTCACCAAGTACACTTCCAGCAAG / slc302 GGGTTAGCGTTAAGATAACTGT (~500 bp band in FBEb mutant, no product in wild-type). Reference: Carrick BH, et al. Dev Cell. 2024. "PUF partner interactions at a conserved interface shape the RNA-binding landscape and cell fate in Caenorhabditis elegans."
JK6694 C. elegans rajSi50 II; unc-119(ed3) III. Show Description
rajSi50 [gld-1p::GFP::H2B::gld-1 3'UTR + Cbr-unc-119(+)] II. Maintain at 24C on OP50. Select well-fed adult animals with bright germline GFP in nuclei to propagate strain. GFP is visible in germline nuclei, low in distal germ cells, increases proximally, strong in oocytes. Kimble lab crossed original NIK50 strain with TX189 [oma-1::GFP] and back out again to reduce GFP silencing. Primers to confirm FBEa: slc314 GTCACCAAGTACACTTCCAGCAAG / slc311 TGGCAACATGATGTATGGCACA (100 bp band in FBEa wt). FBEb: slc314 GTCACCAAGTACACTTCCAGCAAG / slc304 GGGTTAGCGTTAAGATAACACA (~500 bp band in FBEb wt). References: Theil K, et al. Nature Commun. 2019 Sep 16;10(1):4205. doi: 10.1038/s41467-019-12050-7. PMID: 31527589. Carrick BH, et al. Dev Cell. 2024. "PUF partner interactions at a conserved interface shape the RNA-binding landscape and cell fate in Caenorhabditis elegans."
JM149 C. elegans caIs71. Show Description
caIs71[elt-2p::GFP::HIS-2B::unc-54 3'UTR + rol-6(su1006)]. Rollers. Expresses nuclear-localized GFP in all intestinal nuclei under control of 5.2 kb elt-2 promoter. GFP is fused to Histone H2B + (fused pie-1 and truncated unc-54 3'-UTR). Transgene was integrated into N2 background by exposure to gamma rays. Reference: Dineen A, et al. Dev Biol. 2018 Mar 15;435(2):150-161. PMID: 29360433
KAE10 C. elegans seaSi40 I; unc-119(ed3) III. Show Description
seaSi40 [(pCFJ448) (eft-3p::fmo-2 + H2B::GFP) + Cbr-unc-119(+)] I. Higher level of FMO-2 over-expression compared to KAE9. Improved healthspan, stress resistance and longevity. Reference: Leiser SF, et al. Science 350.6266 (2015): 1375-8.
KAE12 C. elegans seaSi182 II; unc-119(ed3) III. Show Description
seaSi182 [(pCFJ150) (vha-6p::fmo-2 + H2B::GFP) + Cbr-unc-119(+)] II. Over-expression of FMO-2 in the intestine. Long-lived. Reference: Leiser SF, et al. Science 350.6266 (2015): 1375-8.
KAE9 C. elegans seaSi39 I; unc-119(ed3) III. Show Description
seaSi39 [(pCFJ448) (eft-3p::fmo-2 + H2B::GFP) + Cbr-unc-119(+)] I. Lower level of FMO-2 over-expression compared to KAE10. Improved healthspan, stress resistance and longevity. Reference: Leiser SF, et al. Science 350.6266 (2015): 1375-8.
MAH74 C. elegans rrf-1(pk1417) I; unc-119(ed3) ruIs32 III. Show Description
ruIs32 [pie-1p::GFP::H2B + unc-119(+)] III. Reference: Kumsta C, Hansen M. PLoS One. 2012;7(5):e35428.
MBA227 C. elegans wIs51 V; icbSi2. Show Description
wIs51 [SCMp::GFP + unc-119(+)]. icbSi2 [dpy-7p::mCherry::H2B::unc-54 + Cbr-unc-119(+)]. Seam cell nuclei labelled with GFP. hyp7 nuclei labelled with mCherry. Reference: Hintze M, et al. Genetics. 2020 Apr;214(4):927-939. doi: 10.1534/genetics.119.302896. PMID: 31988193.
MG152 C. elegans xsIs3 I. Show Description
N2 with integrated array pJH4.52. xsIs3[hisH2B::GFP; rol-6(su1006)]. 39.9.1 Must be kept at 25C to avoid germline-silencing.
MG155 C. elegans xsIs4 IV. Show Description
xsIs4 [hisH2B::GFP + rol-6(su1006)]. N2 with integrated complex-array pJH4.52. Must be kept at 25C to avoid germline-silencing.
MLC1389 C. elegans lucEx824. Show Description
lucEx824 [mab-9::T2A::GFP::H2B::mab-9 3'UTR + ttx-3p::mCherry]. Pick mCherry+ animals to maintain. Wild-type morphology. Extrachromosomal mab-9 reporter includes 3.1 kb of mab-9 upstream region and 1.5 kb of downstream region. Reference: Charest J, et al. Dev Cell. 2020 Sep 24;S1534-5807(20)30672-9. PMID: 33002421
MLC1390 C. elegans lucEx825. Show Description
lucEx825 [tbx-34::T2A::GFP::H2B::tbx-34 3'UTR + ttx-3p::mCherry]. Pick mCherry+ animals to maintain. Wild-type morphology. Extrachromosomal tbx-34 reporter includes 755 bp of tbx-34 upstream region and 4.4 kb of downstream region. Reference: Charest J, et al. Dev Cell. 2020 Sep 24;S1534-5807(20)30672-9. PMID: 33002421
MLC1391 C. elegans lucEx826. Show Description
lucEx826 [tbx-36::T2A::GFP::H2B::tbx-36 3'UTR + ttx-3p::mCherry]. Pick mCherry+ animals to maintain. Wild-type morphology. Extrachromosomal tbx-36 reporter includes 1.5 kb of tbx-36 upstream region and 1.4 kb of downstream region. Reference: Charest J, et al. Dev Cell. 2020 Sep 24;S1534-5807(20)30672-9. PMID: 33002421
MLC1491 C. elegans lucEx881. Show Description
lucEx881 [C32C4.16::T2A::GFP::H2B(fosmid) + unc-122p::mCherry]. Pick mCherry+ animals to maintain. Wild-type morphology. Extrachromosomal C32C4.16 fosmid-based reporter. Reference: Charest J, et al. Dev Cell. 2020 Sep 24;S1534-5807(20)30672-9. PMID: 33002421
MLC1493 C. elegans lucEx883. Show Description
lucEx883 [tbx-43::T2A::GFP::H2B::tbx-43 3’UTR + ttx-3p::mCherry]. Pick mCherry+ animals to maintain. Wild-type morphology. Extrachromosomal tbx-43 reporter includes 2.4 kb of tbx-43 upstream region and 658 bp of downstream region. Reference: Charest J, et al. Dev Cell. 2020 Sep 24;S1534-5807(20)30672-9. PMID: 33002421
MLC1578 C. elegans lucEx935. Show Description
lucEx935 [tbx-39p::tbx-39::T2A::GFP::H2B::tbx-39 3’UTR + ttx-3p::mCherry]. Pick mCherry+ animals to maintain. Wild-type morphology. Extrachromosomal tbx-39 reporter includes 1.6 kb of tbx-39 upstream region and 1.8 kb of downstream region. Reference: Charest J, et al. Dev Cell. 2020 Sep 24;S1534-5807(20)30672-9. PMID: 33002421
MLC2465 C. elegans oxIs322 II; unc-119(ed3) III; lucEx1311. Show Description
oxIs322 [myo-2p::mCherry::H2B + myo-3p::mCherry::H2B + Cbr-unc-119(+)]. lucEx1311 (myo-3p::R2pH::LAMP1::3xFLAG::unc-54 3’UTR + ttx-3p::mCherry). Pick mCherry+ to maintain. Reference: Gutie?rrez-Pérez, P. et al. A deeply conserved miR-1 dependent regulon supports muscle cell physiology. bioRxiv, 2020, doi.org/10.1101/2020.08.31.275644.
MS1893 C. elegans unc-119(ed9) III; irSi24 IV. Show Description
irSi24 [pept-1::mCherry::H2B + Cbr-unc-119(+)] IV. Single-copy MosSCI insertion of pept-1 reporter into cxTi10882 site in LG IV. mCherry fluorescence exclusively in intestinal nuclei from the end of embryonic development through adulthood. Generated in N2 background. Reference: Maduro MF, et al. Dev Biol 2015 Aug 1;404(1):66-79. doi: 10.1016/j.ydbio.2015.04.025, PMID:25959238.
MSB1088 C. elegans unc-119(ed3) III; mirIs110 V. Show Description
mirIs110 [odr-7p::TeNL + unc-122p::GFP *oxTi553 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]] V. GFP expression in coelomycetes. Integration of the calcium sensitive (Kd 250 nM) teal nanolantern (TeNL) into tdTomato in the oxTi553 insertion. Expression of TeNL transgene in AWA by the odr-7 promoter. Reference: Porta-de-la-Riva M, et al. Nat Methods. 2023 May;20(5):761-769. doi: 10.1038/s41592-023-01836-9. PMID: 37024651.
MSB1091 C. elegans mirSi16 II; unc-119(ed3) III; mirIs110 V; mirIs107. Show Description
mirSi16 [flp-18p::lox2272::BFP::tbb-2 3'UTR::lox2272::ChR2-HRDC::SL2::jRGECO1a::unc-54 3'UTR + Cbr-unc-119(+)] II. mirIs110 [odr-7p::TeNL + unc-122p::GFP *oxTi553 [eft-3p::tdTomato::H2B::unc-54 3'UTR + Cbr-unc-119(+)]] V. mirIs107 [gpa:14p::CRE + npr-9p::ChR-HRDC::YFP::SL2::jRGECO1a + rps-0p::hygroR]. Blue fluorescence in flp-18 expressing neurons. Green coelomycetes segregates with calcium sensitive (Kd 250 nM) teal nanolantern (TeNL) in AWA. ChR2-HRDC and jRGECO1a in AVA (instead of BFP) and ChR2-HRDC::YFP and jRGECO1a in AIB. HygroR. Reference: Porta-de-la-Riva M, et al. Nat Methods. 2023 May;20(5):761-769. doi: 10.1038/s41592-023-01836-9. PMID: 37024651.
MSB1247 C. elegans oxSi1091 II; unc-119(ed3) III; oxTi553 V. Show Description
oxSi1091 [mex-5p::Cas9 (+ smu-2 introns)::tbb-2 3'UTR + Cbr-unc-119(+)] II. Slightly sick at 25, mantain at 20C. Cas9 expression in the germline. oxTi553 [eft-3p::tdTomato::H2B] V. Broad nuclear tdTomato expression. Reference: Malaiwong N, et al. G3 (Bethesda). 2023 May 2;13(5):jkad041. doi: 10.1093/g3journal/jkad041. PMID: 36805659.