MT20109 |
C. elegans |
dpy-17(e164) unc-32(e189)/qC1 [dpy-19(e1259) glp-1(q339)] nIs189 III. Show Description
nIs189 [myo-2::GFP] integrated in or near qC1. No recombination seen between nIs189 and qC1. Fails to complement all markers on qC1. Heterozygotes are WT GFP+. Segregates GFP+ Dpy Sterile and non-GFP Dpy Unc.
|
|
MT7554 |
C. elegans |
sqv-3(n2842) unc-69(e587)/qC1 [dpy-19(e1259) glp-1(q339)] III. Show Description
Heterozygotes are WT and segregate WT, Dpy Steriles and Sqv Uncs. n2842: mid-L4 vulva abnormal, sterile.
|
|
MT9454 |
C. elegans |
cup-5(n3194) unc-36(e251)/qC1 [dpy-19(e1259) glp-1(q339)] III. Show Description
Heterozygotes are WT and segregate WT, Sterile Dpys, and Mel Uncs. cup-5(n3194) is a Q139 ochre allele with a maternal effect lethal phenotype including accumulation of refractile bodies resembling apoptotic cells in some regards. cup-5 homozygotes are also defective in coelomocyte uptake.
|
|
BN464 |
C. elegans |
bqSi189 II; mel-28(t1684) unc-32(e189)/qC1 dpy-19(e1259) glp-1(q339) III; ojIs1 Show Description
bqSi189 [lmn-1p::mCherry::his-58 + unc-119(+)] II. ojIs1 [pie-1p::GFP::tbb-2 + unc-119(+)]. Maintain at 25C to help prevent silencing of ojIs1. mel-28 heterozygotes are wild-type and segregate wild-type, DpySteriles, and Uncs which give only dead eggs. ojIs1 is likely integrated into LG V. bqSi189 is a single-copy MosSCI insertion into ttTi5605 derived from injection of pBN13. Derived from GE2622; this strain might still carry him-3(e1147) in the background. Reference: Gomez-Saldivar G, et al. PLoS Genet. 2016 Jun 24;12(6):e1006131.
|
|
BW1369 |
C. elegans |
unc-32(e189) dpy-18(e364) ctDf2/qC1 [dpy-19(e1259) glp-1(q339)] III. Show Description
Heterozygotes are WT and segregate WT, DpySteriles and dead eggs. Maintain by picking WT.
|
|
BW1535 |
C. elegans |
dpy-18(e364) ctDf3 unc-25(e156)/qC1 [dpy-19(e1259) glp-1(q339)] III. Show Description
Heterozygotes are WT and segregate WT, DpySteriles and dead eggs. Maintain by picking WT.
|
|
CH1179 |
C. elegans |
unc-36(e251) emb-9(g23cg46)/qC1 [dpy-19(e1259) glp-1(q339)] III. Show Description
Heterozygotes are WT and segregate WT, Dpy Steriles and 3-fold lethals. cg46 is a 497 bp deletion that removes the last 22 nucleotides of intron 9 and 475 nucleotides of exon 10;
|
|
GE2167 |
C. elegans |
unc-32(e189) tDf5/qC1 [dpy-19(e1259) glp-1(q339)] III; him-3(e1147) IV. Show Description
Heterozygotes are WT and segregate WT, Sterile Dpys and dead eggs. Throws males. Maintain by picking WT. See WBG 13 #4 p.96.
|
|
GE2171 |
C. elegans |
tDf9 unc-32(e189)/qC1 [dpy-19(e1259) glp-1(q339)] III; him-3(e1147) IV. Show Description
Heterozygotes are WT and segregate WT, DpySteriles and dead eggs, and males. tDf9 is embryonic lethal.
|
|
GE2175 |
C. elegans |
unc-32(e189) tDf6/qC1 [dpy-19(e1259) glp-1(q339)] III; him-3(e1147) IV. Show Description
Heterozygotes are WT and segregate WT, Sterile Dpys and dead eggs. Throws males. Maintain by picking WT. See WBG 13 #4 p.96.
|
|
GE2180 |
C. elegans |
unc-32(e189) tDf7/qC1 [dpy-19(e1259) glp-1(q339)] III; him-3(e1147) IV. Show Description
Heterozygotes are WT and segregate WT, Sterile Dpys and dead eggs. Throws males. Maintain by picking WT. See WBG 13 #4 p.96.
|
|
GE2204 |
C. elegans |
unc-32(e189) tDf10/qC1 [dpy-19(e1259) glp-1(q339)] III; him-3(e1147) IV. Show Description
Heterozygotes are WT and segregate WT, DpySteriles and dead eggs, and males. tDf10 is embryonic lethal.
|
|
GE2941 |
C. elegans |
unc-32(e189) let-(t1446)/qC1 [dpy-19(e1259) glp-1(q339)] III; him-3(e1147) IV. Show Description
Heterozygotes are WT and segregate WT, DpySteriles and Uncs which give only dead eggs. This strain was mistakenly called emb-30 in the paper; it is not an emb-30 allele.
|
|
HZ111 |
C. elegans |
muIs16 II; sor-1(bp_1)/qC1 [dpy-19(e1259) glp-1(q339)] III; him-5(e1490) V. Show Description
muIs16 [mab-5::GFP]. Larval lethal at L3/L4 stage. Ectopic expression of GFP in the arrested sor-1 mutant homozygotes (L3 stage). NOTE: This allele is published as bp1, but has been curated in WormBase as bp_1 in order to differentiate it from the STS marker bP1.
|
|
HZ112 |
C. elegans |
muIs16 II; sor-1(bp3)/qC1 [dpy-19(e1259) glp-1(q339)] III; him-5(e1490) V. Show Description
muIs16 [mab-5::GFP]. Larval lethal at L3/L4 stage. Ectopic expression of GFP in the arrested sor-1 mutant homozygotes (L3 stage).
|
|
MLC218 |
C. elegans |
tbx-37(zu467) dpy-18(e364) tbx-38(zu460)/qC1[dpy-19(e1259) glp-1(q339) qIs26] III. Show Description
qIs26 [lag-2::GFP + rol-6(su1006)]. Heterozygote animals show roller phenotype and express GFP in the distal tip cells. Segregate roller and GFP(+) heterozygotes, embryonic lethal qC1 homozygotes and embryonic lethal tbx-37/38 homozygotes. Reference: Charest J, et al. Dev Cell. 2020 Sep 24;S1534-5807(20)30672-9. PMID: 33002421
|
|
MT5523 |
C. elegans |
unc-69(e587) ced-9(n1950n2161)/qC1 [dpy-19(e1259) glp-1(q339)] III. Show Description
Heterozygotes are WT and segregate WT, Uncs and DpySte. n2161 is an intragenic revertant of ced-9(n1950). The unc-69 ced-9 homozygotes have a maternal effect lethal phenotype: their offspring arrest as embryos or L1; they also give very few eggs at 25C.
|
|
VC3983 |
C. elegans |
mrps-26(gk5010[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/qC1[dpy-19(e1259) glp-1(q339)] III. Show Description
Recessive lethal deletion balanced by qC1. Deletion of 993 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: GGGACGATGTCTTTTGGCATCTGCCATGTC; Right flanking sequence: GGACATGATGTGAGTTATTTTTGAACATCG. See WormBase Variation gk5010 for details.
|
|
VT2797 |
C. elegans |
pat-3(st564)/qC1 [dpy-19(e1259) glp-1(q339)] III; mir-83(n4638) IV; mir-34(gk437) X. Show Description
Heterozygotes are superficially WT (with DTC migration defects), and segregate superficially WT (with DTC migration defects), sterile ts-Dpy qC1 homozygotes, and st564 homozygotes (PAT lethal). Pick WT and check for correct segregation of progeny to maintain. Reference: Burke SL, Hammell M, Ambros V. Genetics. 2015 Jun 15.
|
|
BA1013 |
C. elegans |
spe-6(hc49) vab-7(e1562)/qC1 [dpy-19(e1259) glp-1(q339)] III; spe-27(it132) IV. Show Description
Male/hermaphrodite line. Maintain at 15C to insure maintenance of male/hermaphrodite line.
|
|
BA1061 |
C. elegans |
dpy-18(e364) spe-6(hc49) ale-1(mc14)/qC1 [dpy-19(e1259) glp-1(q339)] III. Show Description
Heterozygotes are WT and segregate WT, Sterile Dpys (Dpy is temperature sensitive), and dead eggs. ale-1 is a recessive embryonic lethal.
|
|
EU415 |
C. elegans |
cyk-1(or36) unc-36(e251)/qC1 [dpy-19(e1259) glp-1(q339)] III; him-8(e1489) IV. Show Description
Heterozygotes are WT and segregate WT, Sterile Dpys and Uncs which give only dead eggs at all temperatures. Throws males.
|
|
EU918 |
C. elegans |
lon-1(e185) par-3(it71)/qC1 [dpy-19(e1259) glp-1(q339)] III; spn-4(or191) V. Show Description
Temperature sensitive spn-1. Maintain at 15C. Lethal at 25C. Heterozygotes are WT and segregate WT, Lon which give only dead eggs at all temperatures, and Sterile Dpys(ts).
|
|
FF275 |
C. elegans |
dpy-17(e164) unc-32(f123) ncl-1(e1865)/qC1 [dpy-19(e1259) glp-1(q339)] III. Show Description
Heterozygotes are WT and segregate WT, Dpy Steriles (qC1 homozygotes), and embryonic lethals (f123 homozygotes)
|
|
FF276 |
C. elegans |
dpy-17(e164) unc-32(f121) ncl-1(e1865)/qC1 [dpy-19(e1259) glp-1(q339)] III. Show Description
Heterozygotes are WT and segregate WT, Dpy Steriles (qC1 homozygotes), and larval lethals (f121 homozygotes). g to a transition in exon 6 (2874), changing a Gly in Glu in ZK637.8 gene encoding a V-ATPase alpha subunit
|
|
GE2198 |
C. elegans |
cta-3(t1492) unc-32(e189)/qC1 [dpy-19(e1259) glp-1(q339)] III; him-3(e1147) IV. Show Description
Heterozygotes are WT and segregate WT, DpySteriles, and Uncs which give only dead eggs.
|
|
GE2199 |
C. elegans |
unc-32(e189) nup-1(t1482)/qC1 [dpy-19(e1259) glp-1(q339)] III; him-3(e1147) IV. Show Description
Heterozygotes are WT and segregate WT, DpySteriles, and Uncs which give only dead eggs.
|
|
GE2211 |
C. elegans |
unc-32(e189) sas-1(t1476)/qC1 [dpy-19(e1259) glp-1(q339)] III; him-3(e1147) IV. Show Description
Heterozygotes are WT and segregate WT, DpySteriles, and Uncs which give only dead eggs.
|
|
GE2212 |
C. elegans |
unc-32(e189) com-1(t1489)/qC1 [dpy-19(e1259) glp-1(q339)] III; him-3(e1147) IV. Show Description
Heterozygotes are WT and segregate WT, Dpy Steriles, and Uncs which are Mel with over 99% embryonic lethality.
|
|
GE2219 |
C. elegans |
unc-32(e189) csg-1(t1501)/qC1 [dpy-19(e1259) glp-1(q339)] III; him-3(e1147) IV. Show Description
Heterozygotes are WT and segregate WT, DpySteriles, and Uncs which give only dead eggs.
|
|
GE2238 |
C. elegans |
cyk-1(t1611) unc-32(e189)/qC1 [dpy-19(e1259) glp-1(q339)] III; him-3(e1147) IV. Show Description
Heterozygotes are WT and segregate WT, Sterile Dpys and Uncs which give only dead eggs. Throws males.
|
|
GE2239 |
C. elegans |
unc-32(e189) csg-7(t1612)/qC1 [dpy-19(e1259) glp-1(q339)] III; him-3(e1147) IV. Show Description
Heterozygotes are WT and segregate WT, DpySteriles, and Uncs which give only dead eggs.
|
|
GE2240 |
C. elegans |
apo-3(t1613) unc-32(e189)/qC1 [dpy-19(e1259) glp-1(q339)] III; him-3(e1147) IV. Show Description
Heterozygotes are WT and segregate WT, DpySteriles, and Uncs which give only dead eggs.
|
|
GE2242 |
C. elegans |
cta-1(t1618) unc-32(e189)/qC1 [dpy-19(e1259) glp-1(q339)] III; him-3(e1147) IV. Show Description
Heterozygotes are WT and segregate WT, DpySteriles, and Uncs which give only dead eggs.
|
|
GE2244 |
C. elegans |
unc-32(e189) lit-1(t1512)/qC1 [dpy-19(e1259) glp-1(q339)] III; him-3(e1147) IV. Show Description
Heterozygotes are WT and segregate WT, DpySteriles and Uncs which produce only dead eggs at 25C but viable progeny at 15C. Throws males.
|
|
GE2245 |
C. elegans |
unc-32(e189) tim-1(t1545)/qC1 [dpy-19(e1259) glp-1(q339)] III; him-3(e1147) IV. Show Description
Heterozygotes are WT and segregate WT, DpySteriles, and Uncs which give only dead eggs. tim-1 is temperature sensitive: progeny are viable at 15C, and dead at 25C. Previously called csg-5(t1545). Received new stock 5/04.
|
|
GE2255 |
C. elegans |
unc-32(e189) tbb-2(t1623)/qC1 [dpy-19(e1259) glp-1(q339)] III; him-3(e1147) IV. Show Description
Heterozygotes are WT and segregate WT, DpySteriles, and Uncs which give only dead eggs.
|
|
GE2258 |
C. elegans |
unc-32(e189) com-1(t1626)/qC1 [dpy-19(e1259) glp-1(q339)] III; him-3(e1147) IV. Show Description
Heterozygotes are WT and segregate WT, Dpy Steriles, and Uncs which are Mel with over 99% embryonic lethality.
|
|
GE2259 |
C. elegans |
unc-32(e189) cta-5(t1627)/qC1 [dpy-19(e1259) glp-1(q339)] III; him-3(e1147) IV. Show Description
Heterozygotes are WT and segregate WT, DpySteriles, and Uncs which give only dead eggs.
|
|
GE2345 |
C. elegans |
cyk-3(t1525) unc-32(e189)/qC1 [dpy-19(e1259) glp-1(q339)] III; him-3(e1147) IV. Show Description
Heterozygotes are WT and segregate WT, DpySteriles, and Uncs which give only dead eggs.
|
|
GE2349 |
C. elegans |
unc-32(e189) pnm-5(t1543)/qC1 [dpy-19(e1259) glp-1(q339)] III; him-3(e1147) IV. Show Description
Heterozygotes are WT and segregate WT, DpySteriles, and Uncs which give only dead eggs.
|
|
GE2353 |
C. elegans |
unc-32(e189) lit-1(t1534)/qC1 [dpy-19(e1259) glp-1(q339)] III; him-3(e1147) IV. Show Description
Heterozygotes are WT and segregate WT, Uncs which produce dead eggs, and Dpy Steriles. Throws males.
|
|
GE2358 |
C. elegans |
unc-32(e189) pnm-4(t1491)/qC1 [dpy-19(e1259) glp-1(q339)] III; him-3(e1147) IV. Show Description
Heterozygotes are WT and segregate WT, DpySteriles, and Uncs which give only dead eggs.
|
|
GE2359 |
C. elegans |
unc-32(e189) amo-5(t1478)/qC1 [dpy-19(e1259) glp-1(q339)] III; him-3(e1147) IV. Show Description
Heterozygotes are WT and segregate WT, Dpy Steriles, and embryonic lethals. Throws males. t1478 PKA arm-5.
|
|
GE2364 |
C. elegans |
let-771(t1554) unc-32(e189)/qC1 [dpy-19(e1259) glp-1(q339)] III; him-3(e1147) IV. Show Description
Heterozygotes are WT and segregate WT, DpySteriles, and Uncs which give only dead eggs.
|
|
GE2533 |
C. elegans |
unc-32(e189) zyg-8(t1638)/qC1 [dpy-19(e1259) glp-1(q339)] III; him-3(e1147) IV. Show Description
Heterozygotes are WT and segregate WT, DpySteriles, and Uncs which give only dead eggs. zyg-8(t1638) pka apo-1(t1638). SeeWBPaper00005199.
|
|
GE2534 |
C. elegans |
csg-2(t1637) unc-32(e189)/qC1 [dpy-19(e1259) glp-1(q339)] III; him-3(e1147) IV. Show Description
Heterozygotes are WT and segregate WT, DpySteriles, and Uncs which give only dead eggs.
|
|
GE2576 |
C. elegans |
unc-32(e189) baf-1(t1639)/qC1 [dpy-19(e1259) glp-1(q339)] III; him-3(e1147) IV. Show Description
Heterozygotes are WT and segregate WT, DpySteriles, and Uncs which give only dead eggs.
|
|
GE2606 |
C. elegans |
rot-3(t1640) unc-32(e189)/qC1 [dpy-19(e1259) glp-1(q339)] III; him-3(e1147) IV. Show Description
Heterozygotes are WT and segregate WT, DpySteriles, and Uncs which give only dead eggs.
|
|
GE2614 |
C. elegans |
unc-32(e189) faf-1(t1678)/qC1 [dpy-19(e1259) glp-1(q339)] III; him-3(e1147) IV. Show Description
Heterozygotes are WT and segregate WT, DpySteriles, and Uncs which give only dead eggs.
|
|