F28C6.1. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP gk582 homozygotes (early larval arrest). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: ATGATAAGACGTCCTTGCCG. External right primer: TGCCTCTGCATTGTTCTCAC. Internal left primer: TGTTTGCACTGTTCGACGTT. Internal right primer: GGCGGATTGATTCATATGCT. Internal WT amplicon: 2222 bp. Deletion size: 1146 bp. Deletion left flank: GCGGTTTTTAAAATAACGTGAATATTGCTT. Deletion right flank: GACAAACACTGAGCGAGAAAACGAATCAGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced over nT1. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (gk5827 homozygotes), Vul mKate2+ (nT1) and dead eggs. Derived from parental strains VC4759 and CGC63. gk5827 is a 3755 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: CCGTTCCCGACAACATCAATTTTGCCAGAG; Right flanking sequence: GGCGGTCCATCCAACAGTTGACGTGACGTC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced over nT1. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (gk5828 homozygotes), Vul mKate2+ (nT1) and dead eggs. Derived from parental strains VC4760 and CGC63. gk5828 is a 3391 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: CGTTTGACAAAAAAATATTTTTTAATCTTC; Right flanking sequence: AGGAACAGTTTCAAGCAAGAATTGCATCGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 24013 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: TTTTCACGCTCTTTCCCCCATTTTTCCCCA. Right flanking sequence: GGGTAGGCAACATTTTTATTTCCAACTTTT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. [NOTE: Maintain this strain with care! Non-GFP animals can quickly overtake a population. GFP expression is mottled: the pharynx can look sort of sectored, with bright portions and dim or non-GFP portions, and some GFP animals will throw only non-GFP progeny.]

Homozygous viable. Deletion of 1236 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TGTGCTAAAAATGGTTAATGTGAAAGTCCT. Right flanking sequence: TGATAAATTCTGTTGTTGATTTCAGTTTTC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 577 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: AAGTAATTCAAAGCCAGTGGAGAGTGTCGA. Right flanking sequence: TGGTCTTGACGTTTTTAATGAATTTTTACA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 12549 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: AGAAAAACTGAAAATTAAAAAAAAAGAATT. Right flanking sequence: TTTTGCGTTTGAGATTCTCGAAAAATGGAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 513 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: TCACGGATTTCTGAGCTTTGAAAATAACCG. Right flanking sequence: TGAGATTGTTCGATTGTATTCGAGAACAGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 357 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: GATTTTTCCATTCTTCATTTTCATTTCCCC. Right flanking sequence: ATTTTCAAATTTTGATATTAAATTTTTGAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 10997 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TTTCTGTCAAAAAATCAATAAAAACCAGGC. Right flanking sequence: GGAAGCCAGAAATCCGTGGGGAAAAGTTAC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

[NOTE: Please see RG5046 for balanced version of this strain.] Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 3755 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: CCGTTCCCGACAACATCAATTTTGCCAGAG. Right flanking sequence: GGCGGTCCATCCAACAGTTGACGTGACGTC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

[NOTE: Please see RG5047 for balanced version of this strain.] Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 3391 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: CGTTTGACAAAAAAATATTTTTTAATCTTC. Right flanking sequence: AGGAACAGTTTCAAGCAAGAATTGCATCGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 668 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: GATTCGCTCAGTCCCATCGTTTTCTTGCCG. Right flanking sequence: CGGAGCGTCGTTGGAAATATTTTGGAATTT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.