C34D1.2. Superficially wild type. External left primer: GCGTATGCTCACTTGCTTCA. External right primer: TGGAAACCAGCACAACAAAA. Internal left primer: TTTGATTGTATGTGTCCCGC. Internal right primer: CAATTTGGAAGCTGGGAAAG. Internal WT amplicon: 2086 bp. Deletion size: 1543 bp. Deletion left flank: AAAATATATAAGGAAAGTACAATTAAATAA. Deletion right flank: TGTTGTTGTGTGTACCTGAGTATAAGCAAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Pick viable fertile GFP+ and mKate2+ animals to maintain. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (gk5520 homozygotes), sterile Dpy non-GFP mKate2+ mT1 homozygotes, and large numbers of arrested aneuploid embryos. Derived from parental strains VC4445 and CGC66. gk5520 is a 1322 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: GAGGTCGCAGAAGAACATTGACCCCAGCTC; Right flanking sequence: GAAGAGATAAAACGAAAGCTAAGATTGCAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Pick viable fertile GFP+ and mKate2+ animals to maintain. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (gk5524 homozygotes), sterile Dpy non-GFP mKate2+ mT1 homozygotes, and large numbers of arrested aneuploid embryos. Derived from parental strains VC4449 and CGC66. gk5524 is a 957 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TAACTACTTCTTTCGTTCATAGGTCCATTT. Right flanking sequence: CGAGGACATGGCTGGCTGAAAATAATTTTA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (gk5528 homozygotes), sterile Dpy non-GFP mKate2+ mT1 homozygotes, and large numbers of arrested aneuploid embryos. Derived from parental strains VC4453 and CGC66. gk5528 is a 1052 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence:CTATTTTCAGCGTCTCACAGCATTCCTACA ; Right flanking sequence: GAATTTCTGGAGTCGGAGTTGAATTCAAAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

[NOTE: Please see RG5034 for balanced version of this strain.] Homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 1322 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: GAGGTCGCAGAAGAACATTGACCCCAGCTC; Right flanking sequence: GAAGAGATAAAACGAAAGCTAAGATTGCAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 1067 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: ATGGCAACATAGTCGTCAGCGAGCTCCATG; Right flanking sequence: GAAGCTTCTCGTTTAGTTTTCCCACAAAAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 3366 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TTTATACCGGATTCAAAATTTGTGCCCTCT. Right flanking sequence: ATATCACATTGAGAGCTTGTGAACATATAG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

[NOTE: Please see RG5035 for balanced version of this strain.] Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 957 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: TAACTACTTCTTTCGTTCATAGGTCCATTT. Right flanking sequence: CGAGGACATGGCTGGCTGAAAATAATTTTA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 325 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: TCGTCAAGCTGGAGAAGGAAACGGACAATG; Right flanking sequence: GGAGAAAACGGAAACAACGGTGAGCCACAG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 3203 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: TTTGGCAAAGTACAAGTAACATGCTCACCG; Right flanking sequence: AAAAATACCTCATATGATGATACAGTTTTT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

[NOTE: Please see RG5036 for balanced version of this strain.] Homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 1052 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: CTATTTTCAGCGTCTCACAGCATTCCTACA; Right flanking sequence: GAATTTCTGGAGTCGGAGTTGAATTCAAAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 1132 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: AGACACGCACGAAAATCACGCCAGCACGTT; Right flanking sequence: GTTGGAGTCGTCTCTAAATAATTTTCTTTT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.