| VC1134 |
C. elegans |
C02B4(gk534) X. Show Description
C02B4. Superficially wild type. External left primer: TGTGTGTGTCGAACGTGAAA. External right primer: TCCGATAAAATCTGCTCGCT. Internal left primer: CAGTTTCCCAGCTTTCTTCG. Internal right primer: TGCTCATTGATGTTTGAGGG. Internal WT amplicon: 1884 bp. Deletion size: 657 bp. Deletion left flank: CTAGAACCTACAATCACAAAATAATGCACC. Deletion right flank: ATATATTTATGTTTCAAAGTGTTATGCAAC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC4256 |
C. elegans |
lron-14(gk5340[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) IV. Show Description
Homozygous viable. Deletion of 1972 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: TCTATTATTCTTCTTCAATCTAAATGCTGC; Right flanking sequence: AAGTCATTTTGCTATTTGTGATCTTCAAAG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VC4259 |
C. elegans |
Y51H4A.23(gk5343[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) IV. Show Description
Homozygous viable. Deletion of 812 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: TGGGAATTAATACAACCGCAAAAGTTTGGG; Right flanking sequence: CGAGGAATAAAGATTTGAAAATTGATTGAT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VC4260 |
C. elegans |
Y71H2AM.9(gk5344[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) III. Show Description
Homozygous viable. Deletion of 8243 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: GATCGATCACCTTCTCGCCGTGATTTTCCA; Right flanking sequence: AATGCAACTGCGCTCCATTGCTACGCGCGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VC4261 |
C. elegans |
lron-12(gk5345[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) III. Show Description
Homozygous viable. Deletion of 2072 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: GTCTCCGATTGTATTTCTCAATATTTTAAG; Right flanking sequence: GGACAAGTGTCTCGGAGGGCATTTGAATAT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VC4263 |
C. elegans |
pef-1(gk5346[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) III. Show Description
Homozygous viable. Deletion of 7585 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: GTCGATCAACCAATCTAAAGGCCTCCAGCA; Right flanking sequence: TTTCATGTCTATGCGTCTTGTCACTTATCT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VC4265 |
C. elegans |
psf-2(gk5348[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ I. Show Description
Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 634 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: TTCCCATCAGAAGTGTAAGGCCTCAATATC. Right flanking sequence: TTTGGAGGCCTGTCGTCAGATGGGAGCTGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|