| VC1022 |
C. elegans |
nhr-154(gk527) V. Show Description
C13C4.2. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC4187 |
C. elegans |
ubc-8(gk5273[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) IV. Show Description
Homozygous viable. Deletion of 2800 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TGGGAAAAAATACAAAAAAATCCTGAATTT ; Right flanking sequence: AGATACGGTAGACTACTGTAACCCGGAAAC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VC4189 |
C. elegans |
K03H1.13(gk5275[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) III. Show Description
Homozygous viable. Deletion of 1796 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TTCGAAAACACGATATTTGATTTGAAAGCA ; Right flanking sequence: GATTCATCCGTTACAACTTCTATAGATTCA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VC4194 |
C. elegans |
W02B12.12(gk5279[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) II. Show Description
Homozygous viable. Deletion of 2228 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: ATCCATGGCAAAGCAAGGCAATCGGTTGAT ; Right flanking sequence: TGTGGACTTTTTTTCGAGAAAAAAAATAAC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VC4294 |
C. elegans |
ntl-9(gk5277[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) III. Show Description
Homozygous viable. Deletion of 2075 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: TGCCTCTCCGGCAACTCAAGCTCAACAAAC; Right flanking sequence: TGATCTACCTCGTCTTCTTCGTCCTACTAC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VC4295 |
C. elegans |
lron-5(gk5278[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) III. Show Description
Homozygous viable. Deletion of 2750 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: ATCTCATACAGTTGTATGCAACCGCCCGTC; Right flanking sequence: GTTGACACAACTCGTAACTTTTATTCAATC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VC4381 |
C. elegans |
cpsf-3(gk5271[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/tmC9 IV. Show Description
Homozygous lethal or sterile deletion balanced by tmC9. Deletion of 4391 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain; homozygous tmC9 is non-GFP Mec-3 Unc-31. Left flanking sequence: GTGCCAATTTTCCAATTACTTTTGCCGTTT; Right flanking sequence: CATGGAAGTGCACCACAATGATCCAAATGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VC4382 |
C. elegans |
ptr-1(gk5276[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/tmC3[egl-9(tmIs1230)] V. Show Description
Homozygous lethal or sterile deletion balanced by tmC3. Deletion of 2147 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain; homozygous tmC3 carries myo-2p::mCherry and is Unc-23 Lon-3. Left flanking sequence: GAAAATAGGCAAAAATATTAAACCGTGAAG; Right flanking sequence: GGAAGTGTCATGTTATGATTGACTCCGAAC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|