C50F4.16. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Homozygous viable. Nonsense and splicing alleles identified by amplicon sequencing. The gk5179 mutation is C->T, flanking sequences GGTGAAGCTGAGGCATTACGCGCTTCTCGT and TGAAAAATTTTAATGGATTTTTTGATTCTT. The gk5180 mutation is G->A, flanking sequences AAACTGAAAAGAAGACGTTTCCAATGCTTT and GGATTCTCAACTTATGAATAATCCGATATT. The gk5181 mutation is T->A, flanking sequences AGCATTTGCAGACGGAGATTTTACAACTTG and GAAGAAAATTTTAAAAGACGAGTTGAATCC.

Homozygous viable. Nonsense allele identified by amplicon sequencing. The gk5182 mutation is C->T, flanking sequences TCGTTCTTTCAGGAGACTATCAAAATGGCT and AGCTACTTGTCAATTTCTATGAAACGAATA.

Homozygous viable. Nonsense allele identified by amplicon sequencing. The gk5184 mutation is G->A, flanking sequences CCGACTTGCTGACTGCATTCGGAAGACTAT and GAATAGTGGCCTCGGCGCTTATATGAAACA.

Homozygous viable. Nonsense allele identified by amplicon sequencing. The gk5185 mutation is T->G, flanking sequences GATGATCTTCAACGACATCAACTCATTCTA and GATGAAAAGATTGAGGAGCTCAATGAGTTC.

Homozygous viable. Nonsense and splicing alleles identified by amplicon sequencing. The gk5186 mutation is C->T, flanking sequences TCCGAGATATAGCAGAATTATGATCCAGGA and CAATTTTTTTGATTTAAAATCCATTTTTTG. The gk5187 mutation is G->A, flanking sequences AGATATGAGCGAAGATAAAGTTCTTATTAG and TAAGTAGCTTATTTTTTTAGAAAAAAACAT. The gk5188 mutation is C->T, flanking sequences GAAATCGCCAACATCAACCATTCAGTTAAA and AGCTTCTAACTGATATGGATACGGTGAAAG.

Homozygous viable. Splicing allele identified by amplicon sequencing. The gk5189 mutation is C->T, flanking sequences AATGAGAGCAATGAGAAGAAGCATAAAAAT and TGGAAATATAGAAATATACTTACTTTTAAG.