More Fields
Strain Species Genotype
VC3975 C. elegans +/nT1 IV; sas-5(gk5038[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/nT1 V. Show Description
Recessive lethal deletion balanced by nT1. Deletion of 1442 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TTCAGCTTCCACAAGAAAGGACAAAACCCC; Right flanking sequence: GGTACCTGAGACTCCAGCTGAACGAGAACG. See WormBase Variation gk5038 for details.