Caenorhabditis Genetics Center (CGC)

More Fields
Strain Species Genotype
VC934 C. elegans tag-278(gk382) X. Show Description
C02F12.7. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3864 C. elegans daf-37(gk3829[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) II. Show Description
Homozygous viable. Deletion of 2622 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: GTCATTGGGAACATCACTGATTTATCCCCG; Right flanking sequence: TCTCTCTTTATCCGTTTTCAACATTTTGCA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC3885 C. elegans ilys-4(gk3827[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/nT1 IV; +/nT1 V. Show Description
Homozygous lethal or sterile deletion balanced by nT1. Deletion of 692 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain; homozygous nT1 is non-GFP vulvaless hermaphrodite that bags. Left flanking sequence: CTTAATTTTTTAGTGGAAGACGATCATCCA; Right flanking sequence: GGGAACAATTGGATATTGGAAAAGAGTTCG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.