W06H3.2. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

xnIs78 [cdc-42p::2xHA::cdc-42 + unc-119(+)]. Superficially wild-type. Reference: Anderson DC, et al. (2008) Science 320(5884):1771-4.

Maintain at 15C. cyk-1(or596) is temperature-sensitive embryonic lethal. arIs198 [glt-3p::CFP + glt-3p::LifeAct::TagRFP]; expresses cytoplasmic CFP and LifeAct::TagRFP in the excretory canal cell under control of the glt-3 promoter. Shortened excretory canals.

Maintain at 15C. cyk-1(or596) is temperature-sensitive embryonic lethal. arIs198 [glt-3p::CFP + glt-3p::LifeAct::TagRFP]; expresses cytoplasmic CFP and LifeAct::TagRFP in the excretory canal cell under control of the glt-3 promoter. Shortened excretory canals. Strain is quite sick even at the permissive temperature.

umnIs37 [myo-2p::mKate2 + NeoR, II: 11755713 (intergenic)] II. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced over mKate2 tagged mnC1. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (gk3804 homozygotes), and paralysed DpyUnc mKate2+ (mnC1). Derived from parental strains VC3837 and CGC48. gk3804 is a 717 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TTTGTTATCCGATGGCCAAAAAATTCGCCT. Right flanking sequence: AATGATATCCGAATGTACCATATGGTTCTC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 7 bp. Left flanking sequence: AGCCTTCTGCTGACTAATAACTTTCCATTT; Right flanking sequence: GCGGACTTGCACTGGAAATTTTAATTTCTT. See WormBase Variation gk3858 for details.

Homozygous viable. Deletion of 72 bp with AAAAAAAAAA inserted at break. Left flanking sequence: GGCTATAAGAAGTTGGAGTGCATAAATGAC; Right flanking sequence: TTTTGATCTCAGTTATTACATTAATCAAGG. See WormBase Variation gk3859 for details.

umnIs33 [myo-2p::GFP + NeoR, II: 11755713 (intergenic)] II. Recessive lethal. Nonsense allele identified by amplicon sequencing, balanced by inversion marked with dpy-10 and myo-2 GFP. Heterozygotes are wild-type GFP+, and segregate wild-type GFP+, non-GFP gk3816 homozygotes, and Dpy GFP+ mIn1 homozygotes. Maintain by picking wild-type GFP+ and check for correct segregation of progeny to maintain.

Homozygous viable. Deletion of 800 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: TAATTAGTCAGTATTTTTACTTGCCAGACG. Right flanking sequence: CGGACAAAGTTTTCTTGCTCCGAGGAAATC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 1279 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: ACAGTGGAATGGTTACCCGGTAATACACCC; Right flanking sequence: AGGTACCACAACGGAGGTAAATTTGAAAAA. See WormBase Variation gk3802 for details.

[NOTE: Please see RG5004 for balanced version of this strain.] Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 717 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: TTTGTTATCCGATGGCCAAAAAATTCGCCT. Right flanking sequence: AATGATATCCGAATGTACCATATGGTTCTC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 479 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: AAATGGCTCCACAACGCAGCAACAATAGCA; Right flanking sequence: AGGAGTCACTGTAGTCAAGTACGTGTATGT. See WormBase Variation gk3808 for details.

Homozygous viable. Deletion of 2622 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: GTCATTGGGAACATCACTGATTTATCCCCG; Right flanking sequence: TCTCTCTTTATCCGTTTTCAACATTTTGCA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 1674 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: AATTTATCAGGCGCTTCTTGCGGCCACATT. Right flanking sequence: GGGTTAAACTCGGAAACTTGTTCACAACCC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 515 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: GCAAAATTTGAATAAAAATTGGCCGCGCTA; Right flanking sequence: TGGATGCAGTTGCTTTTTCAAGAGAAGTGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Recessive lethal deletion balanced by nT1. Deletion of 1177 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: ATTGCGACTTGACGAATTTTATCAAGATTA; Right flanking sequence: ATACGATGTCCTCGTTGTCCGAGCAGAATC. See WormBase Variation gk3838 for details.

Recessive lethal deletion balanced by nT1. Deletion of 506 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: CGCAATAATTTTGGGAAAAAACTCAAATTC; Right flanking sequence: GGGTATGGCTTCTAAACTTGCTATAACTTC. See WormBase Variation gk3855 for details.

Homozygous lethal or sterile deletion balanced by nT1. Deletion of 692 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain; homozygous nT1 is non-GFP vulvaless hermaphrodite that bags. Left flanking sequence: CTTAATTTTTTAGTGGAAGACGATCATCCA; Right flanking sequence: GGGAACAATTGGATATTGGAAAAGAGTTCG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 1329 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TTATACCAAATTGTGATCTTTACATCACCG; Right flanking sequence: AGGGGAGCTATTTAAAATTTGAAACTAAAA. See WormBase Variation gk3841 for details.

Homozygous viable. Deletion of 1092 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: GCAGTTCCTATTTCAAACAAAAAAACTCCA; Right flanking sequence: GGGCTTGTTGCTGTCGTTTTCCATTGACTG. See WormBase Variation gk3845 for details.

Apparent homozygous lethal or sterile deletion balanced by eT1. Deletion of 738 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: TTTTCAACAGTGAAAATTTGAATATGCGCG. Right flanking sequence: AATTGGAATGGAAAAGAGCTGGACGCTGTC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 553 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: ATCAGTTATCAAAAATTCGGGGAATCACGA. Right flanking sequence: ACAGGCTATAAACTCGACGAGCACGCTCTC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 2821 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TTCATTGTTATTCAGACACCTGAAAGACCC; Right flanking sequence: TGGAAAAACAGCTGCATCGTCAGATCAACA. See WormBase Variation gk3852 for details.

Homozygous viable. Deletion of 11852 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: TGTTCCCTCACCCTTACTTTCGAATTCCCT. Right flanking sequence: TGGTTGTTTAATATGGTTATTCTTAAGGTA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 1823 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: AAAGATCAAAATGACAGCGGATGGCTTTCA; Right flanking sequence: CGGAGATAAATCATTTGGAAAAGATTGCAC. See WormBase Variation gk3853 for details.

R07G3.1. Homozygous sterile deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP gk388 homozygotes (sterile adult with vulval blip). Pick WT dim GFP and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F58B6.2. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F18E9.5a. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C28A5.3. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F15A4.12, F15A4.11. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F07C6.1. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C02F12.7. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y39E4B.12a. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F18E9.5a. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Heterozygotes are superficially WT (DTC migration defects) with relatively dim pharyngeal GFP signal, and segregate superficially WT (DTC migration defects) with dim GFP, Dpy with bright GFP (mIn1 homozygotes), and non-GFP gk388 homozygotes. Pick WT dim GFP and check for correct segregation of progeny to maintain. Reference: Burke SL, Hammell M, Ambros V. Genetics. 2015 Jun 15.

opIs295 [cdc-42p::GFP::cdc-42(genomic)::cdc-42 3'UTR + unc-119(+)] II. opIs295 fully rescues cdc-42 animals.

Gonadal enlargement and aberrant gonad migration. Phenotype evident at 25C.