More Fields
Strain Species Genotype
VC855 C. elegans cle-1(gk364) I. Show Description
C36B1.1a. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3691 C. elegans C16A11.10(gk3646[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) II. Show Description
Homozygous viable. Deletion of 325 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: AACTGGAAATGTGTGCTTTATTCAGCCATC; Right flanking sequence: AGAAGCCGAAAAAATCAAGTAAATATATAT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC3694 C. elegans sek-4(gk3642[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) X. Show Description
Homozygous viable. Deletion of 490 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: GGTATACGCGAAAATTACACACATTACAGT; Right flanking sequence: AAGCATTTAAAAAGTTTTTGTATTCTGTTT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.