More Fields
Strain Species Genotype
VC793 C. elegans tag-243(gk355) III. Show Description
T04A8.4. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC220 C. elegans cmk-1(ok287) IV; gkDf56 Y102A5C.36(gk3558) V. Show Description
This strain is homozygous for a deletion (ok287) in K07A9.2, detectable by PCR using the following primers. External left primer: CAGTGCCTTTAGGGCTTGAG. External right primer: GGGGTACTGTGGCTGAAAAA. Internal left primer: TAAATCAAACGCCCTTGGAA. Internal right primer: AAACGAAAACCCGGAGAAAT. Internal WT amplicon: 2970 bp. Deletion size: 1921 bp. Deletion left flank: TGCCTAGGATCTGGGGTAGGCCTAGGATCTGGGGTAGGCCTAGGATCTGGGGTAGGCCT AGGATCTGGGGTAGGCCTAGGATC. Deletion right flank: GAAATACGGCGTACACACACGATATTCACG. Validation: ok287 passed by CGH. Other deletions (gkDf56 and gk3558) identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807