ZC8.3. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T04H1.1, F45E10.1, F57C12.3, T04H1.3, T04H1.2. The gk1069 allele was identified by PCR and validated by CGH, and can be detected with PCR using the following primers. External left primer: AAGGAACCTGCGGGATAACT. External right primer: CTTCCAGTAGGCAGTCAGGC. Internal left primer: CTGCTCCTCTTCCACGAGAC. Internal right primer: CCTTGTGTCCGAGTCCTCAT. Internal WT amplicon: 2234 bp. Deletion size: 716 bp. Deletion left flank: AATTGGTTTTTTTGATAAAGTTTGATTAGT. Deletion right flank: TTTCCAATATTTCATCAATTATTTGAACGC. Other lesions identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T01D3.2, F35G12.4. The gk1280 allele was identified by PCR and validated by CGH, and can be detected with PCR using the following primers. External left primer: GTGAAGCCGAAGGATCATGT. External right primer: CGTCTTTGCTTTCTTTTCCG. Internal left primer: GAAGAACTTTGCATCGAGGG. Internal right primer: TGTCCAACAATTTCCAACGA. Internal WT amplicon: 1737 bp. Deletion size: 245 bp. Deletion left flank: TTGCACATTTGAGGCCAATTAAGGTCACAA. Deletion right flank: TTCAAAACTTGTAACTATAATAAAATATTT. Insertion Sequence: ATTTCAGGATGTTTTTGTGAAAG. The gk3152 allele was identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C40D2.4, Y102A11A.2. The gk1252 allele was identified by PCR and validated by CGH, and can be detected with PCR using the following primers. External left primer: CATACCCAAAGGTCTGGTGG. External right primer: GCACAACCTGTGCATGTAGG. Internal left primer: CCACAGACCCGCTATTAAGG. Internal right primer: TTCCCAACACTTCAACGTCA. Internal WT amplicon: 1685 bp. Deletion size: 547 bp. Deletion left flank: AAATTGCAATCGCTTCCGGTAAAATTACTT. Deletion right flank: GTATATGTATATGTATATGTATATGTATATGTATATGTATATGTATATGTATATGTATA TGTATATGTATATGTATATGTATATGTATATGTATATGTTTATGTATATGTATATGTAT ATGTAAATGTATATGTATATGTATATGTATATGTATATGTATATGTATATGTATATGTA TATGTATATGTATATGTATATGCTGAAAGTCGA. The gk3151 allele was identifed by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Homozygous lethal deletion chromosome (gk3159 in Y116A8C.35) balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP gk3159 homozygotes (early larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TTCTGAGCAGTTTGCAGGTG. External right primer: TTTCTGTAAAAATTGGCCGC. Internal left primer: CTCCATATCCGTAGCCTCCA. Internal right primer: GATGCAAGAGACGCAGAGAA. Internal WT amplicon: 2193 bp. Deletion size: 871 bp. Deletion left flank: CCGCCTCCGGAACCTCCACGTTGTGATGGA. Deletion right flank: AGTGGCACGTTCTCTTCACAGCACTTGAGC. Insertion Sequence: G. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807