More Fields
Strain Species Genotype
VC3199 C. elegans tbx-33(gk3098) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Y66A7A.8. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP gk3098 homozygotes (embryonic or early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: ATATTGAAAACTAGGAACTTGGCG. External right primer: CCTACCAGAATCAGTATGCACATC. Internal left primer: CTGAATTTGTTCCATTGTTAGAAAGA. Internal right primer: CTTAAAGTCAAAAACAAACGTTCAAA. Internal WT amplicon: 1543 bp. Deletion size: 474 bp. Deletion left flank: AGGATTAGGCATAGGTTTAGGCTTAGGGTT. Deletion right flank: TTGTAGTTGGATTCTGGATTGAGATGCTCG. Insertion Sequence: GGGCTTAGGATAAAGCTTTGGCTCACGCTTAGGTTTAGGATTAGGTATAGGTTTAGGCT TAGGGTTAGGCTTAGGGTTAGGCTTAGGC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807