F09C3.1. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

M02H5.3. Identified by PCR, validated by CGH. External left primer: TTGTTCCCCAGCACTTTAGG. External right primer: CTCCCGAAACACGGCTAATA. Internal left primer: TAGAACCACATGGTTTCGCA. Internal right primer: TTCCGGGTGCGAGTATTTAG. Internal WT amplicon: 1776 bp. Deletion size: 764 bp. Deletion left flank: GCTTTGAAAGTTATTCGGAACATACCACAG. Deletion right flank: CTCCCAAAATTAACCTAAAACTAAAAAATT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T28F3.1, M01D1.1. The allele gk1230 was identified by PCR, validated by CGH, and can be detected with the following PCR primers. External left primer: CATGGTCAACGAAGCTGAGA. External right primer: GAGAGGCAGAACCGAAGTTG. Internal left primer: TGCGACGAGATCTTGAAGTG. Internal right primer: AAAGCACATTTGGGCAAGAC. Internal WT amplicon: 2703 bp. Deletion size: 1246 bp. Deletion left flank: TTATTCTCTTTTCCCCCAAATCCCCTATAT. Deletion right flank: GGCAAATGGATAGCACGGATCTGAAATTAA. The allele gk3036 was identified by CGH but not confirmed by PCR. Left flanking probe: CTTGTTGCCCATCTCTGATTTACAACTCGGCCCATAGCGTAATTAAAAAT. Right flanking probe: GATATCCCTTCGAGAATAATATCAAAGTTAAATGTATCTTCATGTCGTTG. Left deleted probe: CACTCCAATTTTCCACGAAAATGCTTTGGCTGCATATCATACAATATTCT. Right deleted probe: ACTACCAGTTCACGTGCAGTTTGAGTTTGTTTCATCAAACCCATTAAAAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C52G5. Identified by PCR, validated by CGH. External left primer: TCTTGGCTTTCTGACGTGTG. External right primer: CGTCGTTGGCAAAGGTAAAT. Internal left primer: GTTGAGTGAGCAATGACGGA. Internal right primer: TGCGAAATTTACGCCATACA. Internal WT amplicon: 2398 bp. Deletion size: 977 bp. Deletion left flank: CAGGAACGATTTGCAAACTTCCTGTATAAT. Deletion right flank: GAAAATATCACTAGATATTCTCTTATTCCT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C47E8.6. Identified by PCR, validated by CGH. External left primer: CCGTTACCATGCCAACTCTT. External right primer: TGATTTTGGCCGAGTAGGAC. Internal left primer: CCGTCACCTCTTAACGGAAA. Internal right primer: CGAACCAACCAGAATCTTCG. Internal WT amplicon: 1333 bp. Deletion size: 884 bp. Deletion left flank: TTTTGTTTCAGTTTTCATCGTAATTTTTTT. Deletion right flank: TTTCTTGCAGGTAGGAACTCTGAATATTCG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Unc-22 twitcher. The gk1237 lesion is a point mutation (C to A) with flanks TTCCATATGGATTGGACACCTCGACTGTGT and CTCTCCAGCATCAATGTCCCAAACTTCCTT. The gk1238 lesion is a 122-bp deletion with flanks CTCCATCACTTGCTTCGAATCTATATCTGC and ACGATTTGTGGGCGACTTCCACCGGATTCC, and a single inserted base (C) at the break. Primers to amplify the region are: cggatgcttggaacaaagtt and tgctcgtgtcactggacttc. This strain was isolated after UV/TMP mutagenesis of VC2010 and subjected to whole-genome sequencing (Flibotte et al., Genetics 185: 431 - 441 (2010). In addition to unc-22(gk1237gk1238), it is homozygous for 90 other mutations determined from sequence data. All mutations are annotated in WormBase. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00036200

C05D10.2. External left primer: CAACTATTCTAGAGCCGCCG. External right primer: GCACGACTCTTATCTTCGCC. Internal left primer: ATACTCGGAGCGTGAGTCGT. Internal right primer: TCCGGAAGTGGTGGATAAAC. Internal WT amplicon: 2660 bp. Deletion size: 1407 bp. Deletion left flank: GTCATGATCATCATCATATTTTTATTATCA. Deletion right flank: GCTCCTCAAAAACGATTAACCGTTGAACAA. Insertion Sequence: TTTTTATTATATATTATCATTTTTATTATTA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C45G9.1. External left primer: GAAGGCCGAATCAAATGAAA. External right primer: AAACTGCGAGAAAATCCGAA. Internal left primer: CCTTTGCGCGTAAGATATGG. Internal right primer: ATCAATTAGGCTTCGGGCTT. Internal WT amplicon: 1743 bp. Deletion size: 1228 bp. Deletion left flank: TCTCCTATATGGTCATGACGTTATTGGGGA. Deletion right flank: TCTTATGGAAAACAAAATTTAATATTCTAT. Insertion Sequence: TGGAAAAAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C52B9.3. Identified by PCR, validated by CGH. External left primer: ACATTTTTGTGGCCTTTTCG. External right primer: ATTCCCTTCTCATCCCTGCT. Internal left primer: TTTTCACTTGTCCCTCGACTTT. Internal right primer: TCGTTGAATGTATTTGCAGGTC. Internal WT amplicon: 1349 bp. Deletion size: 448 bp. Deletion left flank: AAATGTGTGCTCAGTTTTTGTTTGCGAAAA. Deletion right flank: TATCAGGTTTGTAGATCACGTTTTCCACTA. Insertion Sequence: CCCTTTAAAAGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807