K02B9.4. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y23H5A.5, C41D11.1, C41D11.6, F21H7.9. The allele gk1227 was identified by PCR, validated by CGH, and can be detected with the following PCR primers. External left primer: AATCACTTTCGGTGCAGCTT. External right primer: GTATGCCCCACAGTTTTGCT. Internal left primer: AGTATCGCGGCATTGTTAGC. Internal right primer: TGCTCAAGCTTGGAGAGACA. Internal WT amplicon: 2419 bp. Deletion size: 367 bp. Deletion left flank: GCTACCACGGAACCTGAATTAGAAATTTCT. Deletion right flank: TATAAATCGTTTAAAAGAGTGACCACTTGC. Insertion Sequence: C. The allele gk3037 was identified by CGH but not confirmed by PCR. Left flanking probe: TCAATTTTGCCCGATCATATGAAGTTTGCAGTTTGCAACCTGTAGTTTGT. Right flanking probe: GAGAACTTGGAGGTGTTCTGTGACACCTGGGGGCAGGCGGTGAGTTATTG. Left deleted probe: AATGTTAGAATCAGCGTGGTCCAGCCTCGTTAGGTAGTCTCTCCGCCGCC. Right deleted probe: GTGCACCCATCTTCGAGGATAGCCAGGGAGAACTTGGAGGTGTTCTGTGA. The allele gk3038 was identified by CGH but not confirmed by PCR. Left flanking probe: AGATGAAGAAATGGGTAGGCTTTCCTTGCTCCCATGATTCCGAAGTTGAT. Right flanking probe: TTTTTAGGCGTTGTCGAGGCCGTAGCCGCCAAAAACGTTAGGCCGCGCAT. Left deleted probe: GATGACTTGTGGACGAAGATCCCATGACTTACTTTGAGCTGCAGTTTCTC. Right deleted probe: GTAAAATCAAATACGCGGAAGTATGTATACCCTTGCCTACTCTAGAATTC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F33D11.7. Identified by PCR, validated by CGH. External left primer: TTGGCTGCCTACTCTCCACT. External right primer: TTTACGTGTTCGGCCTTGAT. Internal left primer: GACCATTTCGGCACAACTTT. Internal right primer: ATACGATCTACGTGGCGGAG. Internal WT amplicon: 1225 bp. Deletion size: 945 bp. Deletion left flank: CACGTTGGAGCAACATGCACAAGACACTGA. Deletion right flank: TGTTACAGAAATATTGATACTTATACATAG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C25A8.5, F45H7.2. The allele gk1224 was identified by PCR, validated by CGH, and can be detected with the following PCR primers. External left primer: GTGGAGCGTTCGGTACATTT. External right primer: TCACACCCCTGACAGGTACA. Internal left primer: AACGGAACCGTTGAGAATTG. Internal right primer: GCCGCCTCACAAGTTAGTTT. Internal WT amplicon: 2303 bp. Deletion size: 1432 bp. Deletion left flank: TTTCCAACGAAAATGTGACTTTTTCAGGAA. Deletion right flank: ATCTACCCATCTTGAGATCAAAACTTTCGA. Insertion Sequence: CAATTTTATTTTAAAAAATGCTCTGTGCCGCTTTTGTCGATACAACTTCTGAAATTTTC AAAACCACCGCGGTGCCTCCCAGTAGGACTTCAAAAATTG. The allele gk3062 was identified by CGH but not confirmed by PCR. Left flanking probe: GAAAAAGATGGATCTAAGATCCACTAATAAGTGAGTACACATACAGTGTG. Right flanking probe: GAAATTTGATTCCGGACCGTATGTACGATGATCTCGATGACCTACCTCTG. Left deleted probe: ATCTACTGTTTGCAGACGACCAAAAGAAACACGTGGCAGACCTGCTCCAA. Right deleted probe: GTTATTTTGTTTTTATCAGCTTCAAGGCGGTCTACATCTGCCTTGCGCCT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

ZK270.2. Identified by PCR, validated by CGH. External left primer: AATGGTGACACGATGCTCAA. External right primer: ACACAGACACAGCAAGACGG. Internal left primer: GTTAAATTCCAGTGGCTGCG. Internal right primer: GAAGCCGATGGACAAAGAGA. Internal WT amplicon: 796 bp. Deletion size: 98 bp. Deletion left flank: AAGTGATCATTCGACCTTTAAAAGTGATGT. Deletion right flank: TTTGGGTGTACCAGTTAGATATATTGGGGT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

ZC374.2, B0564.10, Y67A10A.104, T13F3.1. The allele gk1222 was identified by PCR, validated by CGH, and can be detected with the following PCR primers. External left primer: TTGGAAGTTTTGGCAGGAAT. External right primer: CTTGCGTTAATCGCATGTGT. Internal left primer: TCCAATTTGAGCGATCAGTG. Internal right primer: AGGACGCGCAGATTGTTAGT. Internal WT amplicon: 2448 bp. Deletion size: 1618 bp. Deletion left flank: CATTTTTCAGTGCTGTTTCTTCCACATTAT. Deletion right flank: TCAGATCTTCTAACTCGCGTTTCTAACTTT. The allele gk3024 was identified by CGH but not confirmed by PCR. Left flanking probe: TTTCGACTGCTGCAAATTTGGCACCTCTACCAACGTGAGTTTTACGGATA. Right flanking probe: TTGTTTGAGCTGCCGGGATGCCAGGAGGAGGGAACAGACAGAGCAGGTAT. Left deleted probe: AAAAATTATAATTTACATTTTTCCAGAGCCCAAGCTGCATTCTCCACATC. Right deleted probe: TTCCTCATCGCTCGGCCAACCTTATCAACCCTGTCAGTACAGTGGACCAC. The allele gk3025 was identified by CGH but not confirmed by PCR. Left flanking probe: GGGATTCGTGGTCGAGATTGCCAGTCCAAGGCTTGGTCGGTTTCAGGTTG. Right flanking probe: GGTTAATGTGAAACTTGATTTAACTGTTCCACGAGTATGCTTTAACAATA. Left deleted probe: TGATTCGCAAAAACAACGAATTGTATAGAACTCACACTTTAAGACATCTA. Right deleted probe: AAATTGCTTACTGACTTTGATGCAAAACAGGTGATTTTTCGGGTTCTAAA. The allele gk3061 was identified by CGH but not confirmed by PCR. Left flanking probe: CAGATTATCTCACTTACTGTTATTGCATATTGTGGGACATGTTGCTACTA. Right flanking probe: GGATCACATACTAAACTTAATTCTTTTCAGACCGCAATACCAATGCTTCT. Left deleted probe: ATATTGTGGGACATGTTGCTACTATAAAATACAACAGCAAATGAGGGTTG. Right deleted probe: ACCTACATCGTCAACTGTTCTACGCTTTGGCAATCCAGGTTTGACGCAGC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

ZC374.2. Identified by PCR, validated by CGH. External left primer: CGCTATCCGTTCTCTTTTGC. External right primer: GACAGGTGTGCGAGGTATGA. Internal left primer: ATACCTTTCCGACGTGCAAT. Internal right primer: AATATGACGAAATGTGGCCC. Internal WT amplicon: 2736 bp. Deletion size: 940 bp. Deletion left flank: GATAATGAATGTGAAAGAATGAAGTTAATT. Deletion right flank: CTTACAAATTGCAGAACTATTTATTAGAAT. Insertion Sequence: AGAAAGAATGAAGTTAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F01D4.3. Identified by PCR, validated by CGH. External left primer: TCCTCCAATGGTGGTTGACT. External right primer: CCGGATGGAGACAAAAAGAA. Internal left primer: ATCACTTGCTCCGGTTTCAC. Internal right primer: CCAATTCAGTCTGATGGCAA. Internal WT amplicon: 1179 bp. Deletion size: 505 bp. Deletion left flank: TTTCTCCGCAATCGGTACAACAGTTCCAGT. Deletion right flank: CGCTATTCCAAATACATTTTTCTTTTCAGT. Insertion Sequence: TT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

B0252.1. Identified by PCR, validated by CGH. External left primer: GTAAGCAGCTGCATGGTTGA. External right primer: TGTCTGATTATTTGCCGCAG. Internal left primer: ACTCCCAAAGAGTTCACGGA. Internal right primer: GAATTCTGAACGGAACGGAA. Internal WT amplicon: 1940 bp. Deletion size: 1584 bp. Deletion left flank: AAATCAAAAGATTTGAACTTTCAAAGACTC. Deletion right flank: ATTTTCAACAGAAACCAAAATGTGAGATAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

K09E4.1. Identified by PCR, validated by CGH. External left primer: TCGGCAAATGTGGTTTTGTA. External right primer: CGAGTTCTCTTCCTCAACCG. Internal left primer: ACACAATGGAGCAGCATCAG. Internal right primer: GGCAATCTTGTGGAACACCT. Internal WT amplicon: 1905 bp. Deletion size: 753 bp. Deletion left flank: CAAATTTTTTTGCCGATTTGCCGGAAATTT. Deletion right flank: GCGATGCGGAACAAGTTCACGCTTGGGACG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807