F18C5.2. Homozygous lethal deletion chromosome linked to dpy-10 mutation, balanced by GFP- and dpy-10-marked inversion. Heterozygotes are Dpy with relatively dim GFP expression in pharynx, and segregates Dpy dim GFP, Dpy bright GFP (mIn1 homozygotes) and gk116 homozygotes (embryonic/early larval arrest). Nature of dpy-10 lesion unknown; recessive lethality could be the result of this mutation. Pick Dpy dim GFP+ and check for correct segregation of progeny to maintain." Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y37F4.6. External left primer: CAGAAGTTTGTGGGTTCGGT. External right primer: ACCTGCCTACGTGCCTAGAA. Internal left primer: ACTCCATATCTCCGCAGGAA. Internal right primer: TCCTGGTCCATCTTCGAGTT. Internal WT amplicon: 2083 bp. Deletion size: 990 bp. Deletion left flank: TGAACACTTTTTTGTAAAAAATTTGGTTGC. Deletion right flank: CACGAGGGGCGTGGCCAACGACAATGATTG. Insertion Sequence: CGAGTTGGAACCAATTGATTTGAGCTTCATTATTTTTGAATATTCTAAATAGTTAAAGG TCT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F26A1.4. External left primer: TTTAGGTCTGGCACTACCCG. External right primer: AAAACATTGACACACCTGCG. Internal left primer: AAAGCGGCAGCAGTTAAGAA. Internal right primer: CTACCGGTACTGCCATTCGT. Internal WT amplicon: 1327 bp. Deletion size: 174 bp. Deletion left flank: TTATGTTTATGTTTCAGTTCTGACACGCCA. Deletion right flank: TTAAAATATTTCAGATTGAATGTGGAGATG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F41G3. External left primer: CGTCACTCGACCAAGTAGCA. External right primer: ACTGCGAACGACGTAGTCAA. Internal left primer: GAAATCAAAGGCAGAAGGCA. Internal right primer: GTGCATAGTCAGGTGCATCG. Internal WT amplicon: 2071 bp. Deletion size: 274 bp. Deletion left flank: GTAAGATAAATAATCATGTTTATTTTCCGT. Deletion right flank: GCATTAGAAAATTTATATATTGTTTGCAAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

This strain is homozygous for a deletion (gk1161) in F39F10.2, detectable by PCR using the following primers. External left primer: GTGCTCACCGAGATGTCTGA. External right primer: GCTGATTTCGCTCAACACAA. Internal left primer: GACCCGGTAATTGAGCAGAA. Internal right primer: TGCGAACATTCGTTGAGTTC. Internal WT amplicon: 2489 bp. Deletion size: 500 bp. Deletion left flank: TTCAATTAGGATGTCGTAAACGCAGTGGCT. Deletion right flank: GTGATATCCTAAAAATTATGTTTAAGTTAT. Validation: gk1161 passed by CGH. Other deletions (gk3210, gk3211, gk3212) identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F26A1.4, M04C7.4. The allele gk1160 was identified by PCR, validated by CGH, and can be detected with the following PCR primers. External left primer: TTTAGGTCTGGCACTACCCG. External right primer: AAAACATTGACACACCTGCG. Internal left primer: AAAGCGGCAGCAGTTAAGAA. Internal right primer: CTACCGGTACTGCCATTCGT. Internal WT amplicon: 1327 bp. Deletion size: 126 bp. Deletion left flank: TCACGGATCGGACTCTTTACCGTGCAATGG. Deletion right flank: TTTTTTAAATTGAAAATGCGAGCATCTAGG. The allele gk3034 was identified by CGH but not confirmed by PCR. Left flanking probe: GTACGGTAAGTTGGCCGAGTTGCATTATTCGTCTCGTTCAAGAGGATAAC. Right flanking probe: CAGGCACGCAGGCGCATCTGCACGTACCATGGCTACTTTAGCTGATGAAC. Left deleted probe: GATTTTATCAGCATACGGGCTCGTAAAAGAGAAGAGGAGACGAGGTTACG. Right deleted probe: CTGTGGCTGCTGTTCCAAATGCCAATCTGGAAATGGGAATTTCGGTAACT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y111B2A.1. External left primer: GAAGCTCGAAGAGTGGGATG. External right primer: AGTGTATGCAGCGTGTTTGC. Internal left primer: CCTCTTTGAATTACCGCCAA. Internal right primer: TTTCAGATGAAACGTGCGAG. Internal WT amplicon: 2262 bp. Deletion size: 614 bp. Deletion left flank: TTAATTAATTTCACTGATTTACGCCTGTAA. Deletion right flank: AAAATTGTTTCCAGCCGCTGCGACAATGAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F27C8. External left primer: CTGGAGCATTTGATTCGGTT. External right primer: ATTCATAAACTGGGAGGGGG. Internal left primer: TCCTCAACTTCGCTTCGAGT. Internal right primer: ATTTCGAACTTCATGCGGTC. Internal WT amplicon: 2141 bp. Deletion size: 227 bp. Deletion left flank: TCTTGATTCGATTTCACAGTGATGAATCAA. Deletion right flank: AATGTTTACATTTCCATTTCCAGGTCGATT. Insertion Sequence: A. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807