D2089.4. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C34D1.1. Identified by PCR, validated by CGH. External left primer: AGGCTGACGGCTTCTAATGA. External right primer: GCGGTAGTGCATTCCAATTT. Internal left primer: GATGGCTGGAATGTTGGAGT. Internal right primer: GAGACATGCACACTAGCCGA. Internal WT amplicon: 1370 bp. Deletion size: 265 bp. Deletion left flank: TACGCACCTTTTGTGTCCCTTCAGGCGTGA. Deletion right flank: AGAAAAATAAAGTAAAAGAAACTGGAAAAT. Insertion Sequence: ATG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C34D1.1. External left primer: AGGCTGACGGCTTCTAATGA. External right primer: GCGGTAGTGCATTCCAATTT. Internal left primer: GATGGCTGGAATGTTGGAGT. Internal right primer: GAGACATGCACACTAGCCGA. Internal WT amplicon: 1370 bp. Deletion size: 571 bp. Deletion left flank: AAAAAGGAAAACGGTGTTTTCTACTACCAC. Deletion right flank: GTGAGTGCTGGAGGAGGTTGTTTTTCGAAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C34D1.1, B0462.4. The allele gk1133 was identified by PCR, validated by CGH, and can be detected with the following PCR primers. External left primer: AGGCTGACGGCTTCTAATGA. External right primer: GCGGTAGTGCATTCCAATTT. Internal left primer: GATGGCTGGAATGTTGGAGT. Internal right primer: GAGACATGCACACTAGCCGA. Internal WT amplicon: 1370 bp. Deletion size: 337 bp. Deletion left flank: TTTTTTTCAGATATTTAGGTTAGTCCACTT. Deletion right flank: GGGCACGCCCACTTTATACTATTTTGATGT. Insertion Sequence: TAT. The allele gk3031 was identified by CGH and not confirmed by PCR. Left flanking probe: TTATAAACAGAGACAAATTTAGACCAAAACTCTGTAGGAAAGTGAGTTTT. Right flanking probe: ACAGGAATATGAATTGAGTGATTGCTTGTGGTAGACTCTGTAGATGGTCT. Left deleted probe: AAGTGAGTTTTTCCGTGTGTTCTGTGGGATCAGGTGCTCCAAATCTTCCA. Right deleted probe: GCGCCAATGCTAATATTATACTTATATAAAAGCACTTAACAAGCTGAGCT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

This strain is homozygous for a deletion (gk1130) in B0336.11, detectable by PCR using the following primers. External left primer: TGTTTCCTGAAGTGGCACAG. External right primer: AGCACTCACTGAAGGGGAGA. Internal left primer: ATTCTGCCTTGTTGCTTGCT. Internal right primer: CCGTTGCTCTCTGTGCTCTA. Internal WT amplicon: 2566 bp. Deletion size: 416 bp. Deletion left flank: TAATAAACTTCATTGCGTCAAAGCTCTGAA. Deletion right flank: CATAATTGCATATGCAATATCTACATCGTA. Validation: gk1130 passed by CGH. Other deletion (gk3213) identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

R07B7.16. External left primer: ATGGTGCATTGATGGTCAGA. External right primer: GCGGAAAACTCCAAACGATA. Internal left primer: CTTCCTGAATCAGCACAGCA. Internal right primer: GGCCCGTCTTGTTAACTTCA. Internal WT amplicon: 2735 bp. Deletion size: 1749 bp. Deletion left flank: TACTGTGAATATTGAACTGATCCATGAAAT. Deletion right flank: ATAGAGTTTCAGCTGTCCCTGGTCTCACAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T12D8.8. Identified by PCR, validated by CGH. External left primer: CGAATCGATCCGATCTTCAT. External right primer: GGGATCGATAATGGCTCAGA. Internal left primer: GTTTCCGGAGTTGGAACTGA. Internal right primer: TTGCGAACAACAAATCCTCA. Internal WT amplicon: 1279 bp. Deletion size: 764 bp. Deletion left flank: AAGAAATCAACACAATTTAATGTTAAAGAT. Deletion right flank: GAACCCGCTCTCTACGCTCCGCGAGCTCGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y106G6H.14. Identified by PCR, validated by CGH. External left primer: GGATGCTAGTTTGGAGAGCG. External right primer: AACAGCTGACAAGGAGCGAT. Internal left primer: GTGAACCATCCGATTATGCC. Internal right primer: AATTCGAGAAGAACGATGCG. Internal WT amplicon: 1747 bp. Deletion size: 767 bp. Deletion left flank: CGTTATTCAGCCGCAAAATTAGAGAAATCT. Deletion right flank: AGACATTCAGCCAGCATATCCATATTTCCA. Insertion Sequence: CGACTTTCGCGACG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T19D12.5. External left primer: TCCACTCAAGATGACACCCA. External right primer: CACATTAGGCCAAAATGCCT. Internal left primer: CGGCAAACTTCTGGAACAAT. Internal right primer: ACAATCCCAGCATCCGTATC. Internal WT amplicon: 1654 bp. Deletion size: 685 bp. Deletion left flank: ACAACTTCTTCTGATTTTTCAAGATGTTTC. Deletion right flank: TCCACCTTTTCCAATCAATCCCTCAATCAA. Insertion Sequence: AAGATT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807