Superficially wild-type.

Normal lifespan. Increased sensitivity to oxidative stress, osmotic stress, cold stress, and heat stress. Slow development, slow physiological rates (thrashing, defecation), and reduced fertility. van Raamsdonk J & Hekimi S. Proc Natl Acad Sci U S A. 2012 Apr 10;109(15):5785-90.

F55H2.1. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C28D4.9. External left primer: CTATTGTTTCTTGCGTGGCA. External right primer: ACACACAGGACGAATTTCCC. Internal left primer: GAAGCAGGCATGTGTTGGTA. Internal right primer: AGCCCATTTCGATTCAACAA. Internal WT amplicon: 2019 bp. Deletion size: 790 bp. Deletion left flank: AGAGGCATGAGACAACGAAAGCGTATTCTA. Deletion right flank: TTTTTTGAAAGCTTTTCTATTTGCTATTCA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F21C3.6. External left primer: TGAATTTGTGGTTGGGGATT. External right primer: AACAATCAACGGATGAAGGC. Internal left primer: TGATGGCTGACTTTGAGCAT. Internal right primer: GCGTCACTGATTGGTCTGAA. Internal WT amplicon: 1902 bp. Deletion size: 853 bp. Deletion left flank: AGTGAAAGAAAACAAAATTGTGTTTAAAAA. Deletion right flank: AGTGAAAACTACAAGACCAATAAGGGATTC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y41D4B.20. External left primer: TCTCGTTGCTTCCAAGTGTG. External right primer: AGGTGGCTATTTCGCATGTC. Internal left primer: TGTTGGACGATATGGAGCTG. Internal right primer: CAGCCAATTTCCGAGGTAGA. Internal WT amplicon: 2357 bp. Deletion size: 1043 bp. Deletion left flank: TTTCTTTGTACAAAAACCATCACCAGCCTC. Deletion right flank: GAAATTTTGAACATCGAACCAACTATCCTG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

ZK993.1. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP gk1015 homozygotes (probable early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GAATGGAGAGACGGGTGTGT. External right primer: TTGAAAATTGTGAAGCTGCG. Internal left primer: GGCGCCAGAGTTTGATCTAC. Internal right primer: AGGTTGATGTGGACGGAGAG. Internal WT amplicon: 1907 bp. Deletion size: 1113 bp. Deletion left flank: CAAAATCTTGGTAGTCTAGAAAACCCCAAT. Deletion right flank: CATGGTGTCCTAGGAATATTTTTAAAAAAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

K04H4.7. External left primer: CCTAGTGTACTTCCGTATCCG. External right primer: GTGCAGCGACTTGATAGTGAG. Internal left primer: ATAGTCAGTGAGAGACGCTGG. Internal right primer: CCGCCTTCGATCGATTTTCTG. Internal WT amplicon: 2295 bp. Deletion size: 673 bp. Deletion left flank: CGCCTATAATATAAATCCAATAAAATTTGA. Deletion right flank: GTTGAACAAGTTTTAATAAAACCAATGGCA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F59C6.2. External left primer: AATGAGCTTGTTTGGATGGG. External right primer: GCTTCGAGGAAGAAACGAGA. Internal left primer: GCACAACCAGAGAGAAAGGC. Internal right primer: CCATCTCACCAAGCCCTAAC. Internal WT amplicon: 1657 bp. Deletion size: 375 bp. Deletion left flank: GATGCATTTGAACCTTTCTAACTTCTCAAA. Deletion right flank: GTGGTTTTTTATATTGAGTTTTTTTGGTTG. Insertion Sequence: CTTCATCATGTGCAACAGATGTCATCGCCTTCCACCACGAG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y17G7B.22. External left primer: CCCGTAGTTCATCGATTGCT. External right primer: AAAAAGAATACCACCGGCCT. Internal left primer: ATCTGTTGCCTTCTGTTGGG. Internal right primer: TCGCAGGAGTTTGGGTACTT. Internal WT amplicon: 2119 bp. Deletion size: 1795 bp. Deletion left flank: AAAGACGAAATTGAGAAGAAAATTGCTGAG. Deletion right flank: TTTTGGTGCTTCAAAAAACATCAAAAAATA. Insertion Sequence: AAAATTTGATACTTTTTGATGTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y17G7B.22. External left primer: CCCGTAGTTCATCGATTGCT. External right primer: AAAAAGAATACCACCGGCCT. Internal left primer: ATCTGTTGCCTTCTGTTGGG. Internal right primer: TCGCAGGAGTTTGGGTACTT. Internal WT amplicon: 2119 bp. Deletion size: 1350 bp. Deletion left flank: AATGGACCTGAAAGATTGAAAACAATTGAC. Deletion right flank: TTTTGGTGCTTCAAAAAACATCAAAAAATA. Insertion Sequence: GTGTGGTAAGCGAAAGTAAGCGAAAATTCAAGCTTCGATTGAATTATCATTTCAAAAAG AAATAAATGGAAAACGTATTGTAATCGCTGAACAAACTCCAAAAAATTTGATACTTTTT GATGTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y48G2A.20. External left primer: TCGCAATGAGTGTTCTCCTG. External right primer: CTCATTCCCTGAACTCTCGC. Internal left primer: GGACAGGCCGCATACATATT. Internal right primer: ATCTCAAGAACGTTCACCGC. Internal WT amplicon: 2280 bp. Deletion size: 415 bp. Deletion left flank: TGTCATCCAATAAAACCATTTTGTGAGAGT. Deletion right flank: GGAAATTTCCATCTTCTGATTAGAGGTCAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C15C8.2. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP gk1011 homozygotes (probable early larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TCAACATCACCCAACTGGAA. External right primer: ACATGATGACCCTTTAGCGG. Internal left primer: CATCCTGCAGCTCAAGTGAA. Internal right primer: GCTTACACGCATGCCATAAA. Internal WT amplicon: 1542 bp. Deletion size: 516 bp. Deletion left flank: GAGTTCGGGAGGTAGATGGTCAGGGCGTGA. Deletion right flank: TGATTAGGTTTTGACTATTTAAAAAAGCTG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807