F59D12.1. External left primer: CTCACAAAAAGGGGCGAATA. External right primer: TACCCCTTACACTAACGGCG. Internal left primer: GGTTGTGTTCTATCCCGACG. Internal right primer: ATGAGTGCTTGGGACTTTGG. Internal WT amplicon: 937 bp. Deletion size: 198 bp. Deletion left flank: CTTTAACACAGGCTGGAAAATCTGGTCAGC. Deletion right flank: CCATTTGATATGGATTTATCAATGGTAAGT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Million Mutation Project strain. This strain was isolated after UV/TMP mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). It also carries a homozygous deletion in M01D1.2 (gk1188), identified by CGH (Comparative Genome Hybridization). Minimum deletion size: 345 bp; maximum size 5952 bp. Left flanking probe: TGAAATCGGTGAGCTTTTGGTCTGGGTAAGCTCTCAGGAGGAGCCAGCCT. Right flanking probe: CTATTCAACCCCCATGCGTTGGATGAAGCCTTCCCAATGTCCAACCTTTA. Left deleted probe: AAGCCCTGCGATCACTGGTAAGCTCCTGATCACCCTATTACTTGCACAGT. Right deleted probe: AATCGCAGAGATTGTCAGCGACTTGAAGCTCGGCGGATTGGACAGGCCGT. Flanking sequences represent the nearest array oligo sequences present in the deletion chromsome on the basis of fluorescence ratio. These should not be considered hard breakpoints in the absence of actual sequence data. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537

Million Mutation Project strain. This strain was isolated after UV/TMP mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537

Million Mutation Project strain. This strain was isolated after UV/TMP mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). It also carries a homozygous deletion in B0310.1 (gk1191), identified by CGH (Comparative Genome Hybridization), which can be detected by PCR with the following primers. External left primer: GAATCCGAGAAAAGCGTCTG. External right primer: GATCTTTTGGCCTTTTGCTG. Internal left primer: TCATCCACGTAGACTTGCCA. Internal right primer: TTGCAATCCTGAAGCAAATG. Internal WT amplicon: 2706 bp. Maximum deletion size: 1911 bp. Minimum deletion size: 881 bp. The deletion was confirmed by PCR, but was not sequenced. Left flanking CGH probe: CAAAACGCGTGTTAACCCTGTGCCATCTGTCTGATCCGACTCAGAAAACA. Left deleted CGH probe: TTTCTGAATACAAGAGAAGAGCATAATGGGCGCTGATCTTCCACCGAAAT. Right deleted CGH probe: AATACATTTAAGCTACACACCTACTTGCCTGCTCTCAGTGTGACCGAAAA. Right flanking CGH probe: AAGTTTATGGGCCTGAAACAATTGTATTTTCGTATCTTGACATTGATAAA. Flanking sequences represent the nearest array oligo sequences present in the deletion chromsome on the basis of fluorescence ratio. These should not be considered hard breakpoints in the absence of actual sequence data. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537

Million Mutation Project strain. This strain was isolated after UV/TMP mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537

Million Mutation Project strain. This strain was isolated after UV/TMP mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). It also carries a homozygous deletion in F19C6.1 (gk1192), identified by CGH (Comparative Genome Hybridization), which can be detected by PCR with the following primers. External left primer: CGAACTCGCCGTTCTACTTC. External right primer: GTTTTAGCGGCTTCAACTGC. Internal left primer: CGTCCCTTGATTGGTTCATT. Internal right primer: GATTCTCATTGGCAGACGGT. Internal WT amplicon: 3924 bp. Approximate deletion size: 2575 bp. The deletion was confirmed by PCR, but was not sequenced. Left flanking CGH probe: TTCGTTCAAGCTTAATGTTTCAGCATGCCTCTTCTTGACTCGCTTCTTTT. Left deleted CGH probe: TCCGGTACCAATTGTCGACTTGCTACCATTTTACGACCGCACAACTAAAA. Right deleted CGH probe: TAGTGAGGGAACTGTAGATAATTCTTCCACTTTTTGCTTTTTCCTTTCTT. Right flanking CGH probe: TACCGTATTGGCAACGATATTTTCAATCTCCATGGTCCTATCGTGGCTGA. Flanking sequences represent the nearest array oligo sequences present in the deletion chromsome on the basis of fluorescence ratio. These should not be considered hard breakpoints in the absence of actual sequence data. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537

Million Mutation Project strain. This strain was isolated after UV/TMP mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537

Million Mutation Project strain. This strain was isolated after UV/TMP mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537

Million Mutation Project strain. This strain was isolated after UV/TMP mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537

Million Mutation Project strain. This strain was isolated after UV/TMP mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). It also carries a homozygous deletion in F42A10.1 (gk1194), identified by CGH (Comparative Genome Hybridization), which can be detected by PCR with the following primers. External left primer: TGGCTTTGCAATCTGTTGAG. External right primer: ATGCTTGCTCGTTGTCTGTG. Internal left primer: ACTTGATTCTTGACGAGCCT. Internal right primer: CAACTGATAAGAGTGGTTCGCA. Internal WT amplicon: 906 bp. Maximum deletion size: 137 bp. Minimum deletion size: 101 bp. The deletion was confirmed by PCR, but was not sequenced. Left flanking probe: TTTTGTTTCGCATTCGGTTGTTTCCCATATTTCACCCAGTTTCCACGTTT. Left deleted probe: TATTAAATTGTTCACTTCAAAATTTAAGTATGAGTGAGAGCTCTAGCCTG. Right deleted probe: AAATAATGCAAAGGTCTTCCTTGCTCGGGTCATCATGAAGAAGATACTCG. Right flanking probe: GGGTCATCATGAAGAAGATACTCGAGTTGGTAAGGCTTATCGTTCTGAAA. Flanking sequences represent the nearest array oligo sequences present in the deletion chromsome on the basis of fluorescence ratio. These should not be considered hard breakpoints in the absence of actual sequence data. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537

Million Mutation Project strain. This strain was isolated after UV/TMP mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). It also carries homozygous deletions in C26C6.1 (gk1195) and F14D12.6 (gk1196), identified by CGH (Comparative Genome Hybridization), and confirmed by PCR but not sequenced. The deletions can be detected by the following primers. gk1195: External left primer: ACGGAAGTTCTCAAAGCGAA. External right primer: TCGTCTTCAGCAGTGAATGG. Internal left primer: GCAGGCTCTTCAATGTACGA. Internal right primer: TCTCGGAAAGGCGTAAGAAA. Internal WT amplicon: 506 bp. Approximate deletion size: 100 bp. gk1196: External left primer: CCGGGAAATCACAGCACTAT. External right primer: TACGAATGCAGCGACAGAAC. Internal left primer: AGGATTCACGACGAATGTCC. Internal right primer: CTTCTCGGTAACTTCGCCAC. Internal WT amplicon: 1785 bp. Approximate deletion size: 900 bp. gk1195 left flanking probe: GATGAGGAGGGAGGAAACAAACCGGCGATGGTGAAAAGACATGTAGGATA. gk1195 left deleted probe: TTTCTGCATGTTATTAATTAAATTCTTTTCAGGAAAGCGAAGTCGAAATG. gk1195 right deleted probe: ATATGTGGCACCATGTTACGCATACGTTTCCCGATCTGACGAGAAGAAAA. gk1195 right flanking probe: ACGCATACGTTTCCCGATCTGACGAGAAGAAAACTCCTCTTCACATTTTC. gk1196 left flanking probe: AGCAACCGACATCTGGACGACACGTCGCCGTAGCTCCTTTTGAGTGACGT. gk1196 left deleted probe: GCTCAAATTGCAAACTAGTTTTCATTTGTAGAACTCCATGAGTGGATGAA. gk1196 right deleted probe: TCTCTGTTTCCTTCAGTCGCTGCCTACTATGACGGATGGTTATACTGTAG. gk1196 right flanking probe: CTATGACGGATGGTTATACTGTAGATTTTGGCATAAACGATGATGAGAAT. Flanking sequences represent the nearest array oligo sequences present in the deletion chromsome on the basis of fluorescence ratio. These should not be considered hard breakpoints in the absence of actual sequence data. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537

Million Mutation Project strain. This strain was isolated after EMS mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537

Million Mutation Project strain. This strain was isolated after EMS mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537

Million Mutation Project strain. This strain was isolated after EMS mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537

Million Mutation Project strain. This strain was isolated after EMS mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537

Million Mutation Project strain. This strain was isolated after EMS mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537

Million Mutation Project strain. This strain was isolated after EMS mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537

Million Mutation Project strain. This strain was isolated after EMS mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537

Million Mutation Project strain. This strain was isolated after EMS mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537

Million Mutation Project strain. This strain was isolated after EMS mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537

Million Mutation Project strain. This strain was isolated after EMS mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537

Million Mutation Project strain. This strain was isolated after EMS mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537

Million Mutation Project strain. This strain was isolated after EMS mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537

Million Mutation Project strain. This strain was isolated after EMS mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537

Million Mutation Project strain. This strain was isolated after EMS mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537

Million Mutation Project strain. This strain was isolated after EMS mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537

Million Mutation Project strain. This strain was isolated after EMS mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537

Million Mutation Project strain. This strain was isolated after EMS mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537

Million Mutation Project strain. This strain was isolated after EMS mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537

Million Mutation Project strain. This strain was isolated after EMS mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537

Million Mutation Project strain. This strain was isolated after EMS mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537

Million Mutation Project strain. This strain was isolated after EMS mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537

Million Mutation Project strain. This strain was isolated after EMS mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537

Million Mutation Project strain. This strain was isolated after EMS mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537

Million Mutation Project strain. This strain was isolated after EMS mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537

Million Mutation Project strain. This strain was isolated after EMS mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537

Million Mutation Project strain. This strain was isolated after EMS mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537

Million Mutation Project strain. This strain was isolated after EMS mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537

Million Mutation Project strain. This strain was isolated after EMS mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537

Million Mutation Project strain. This strain was isolated after EMS mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537

Million Mutation Project strain. This strain was isolated after EMS mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537

Million Mutation Project strain. This strain was isolated after EMS mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537

Million Mutation Project strain. This strain was isolated after EMS mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537

Million Mutation Project strain. This strain was isolated after EMS mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537

Million Mutation Project strain. This strain was isolated after EMS mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537

Million Mutation Project strain. This strain was isolated after EMS mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537

Million Mutation Project strain. This strain was isolated after EMS mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537

Million Mutation Project strain. This strain was isolated after EMS mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537

Million Mutation Project strain. This strain was isolated after EMS mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537

Million Mutation Project strain. This strain was isolated after EMS mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537