VT1479 |
C. elegans |
unc-119(ed3) III; maIs182. Show Description
maIs182 [mir-251p::GFP + unc-119(+)]. Wild type.
|
|
VT1481 |
C. elegans |
unc-119(ed3) III; maIs184. Show Description
maIs184 [mir-51::GFP + unc-119(+)]. Wild type.
|
|
VT1482 |
C. elegans |
unc-119(ed3) III; maIs185. Show Description
maIs185 [mir-2p::GFP + unc-119(+)]. Wild type.
|
|
VT1485 |
C. elegans |
unc-119(ed3) III; maIs188. Show Description
maIs188 [mir-228p::GFP + unc-119(+)]. Wild type.
|
|
VT1486 |
C. elegans |
unc-119(ed3) III; maIs189. Show Description
maIs189 [mir-54-56p::GFP + unc-119(+)]. Wild type.
|
|
VT1488 |
C. elegans |
unc-119(ed3) III; maIs191. Show Description
maIs191 [mir-235p::GFP + unc-119(+)]. Wild type.
|
|
VT1492 |
C. elegans |
unc-119(ed3) III; maIs196. Show Description
maIs196 [mir-227-80p::GFP + unc-119(+)]. Wild type.
|
|
VT1494 |
C. elegans |
unc-119(ed3) III; maIs197. Show Description
maIs197 [mir-234p::GFP + unc-119(+)]. Wild type.
|
|
VT1503 |
C. elegans |
unc-119(ed3) III; maIs206. Show Description
maIs206 [mir-81p::GFP + unc-119(+)]. Wild type.
|
|
VT1539 |
C. elegans |
unc-119(ed3) III; maIs218. Show Description
maIs218 [mir-231p::GFP + unc-119(+)]. Wild type.
|
|
VT1541 |
C. elegans |
unc-119(ed3) III; maIs220. Show Description
maIs220 [mir-360p::GFP + unc-119(+)]. Wild type.
|
|
VT1598 |
C. elegans |
unc-119(ed3) III; maIs227. Show Description
maIs227 [mir-90p::GFP + unc-119(+)]. Wild type.
|
|
VT1600 |
C. elegans |
unc-119(ed3) III; maIs229. Show Description
maIs229 [mir-85p::GFP + unc-119(+)]. Wild type.
|
|
VT1605 |
C. elegans |
unc-119(ed3) III; maIs234. Show Description
maIs234 [mir-53::GFP + unc-119(+)]. Wild type.
|
|
VT1607 |
C. elegans |
unc-119(ed3) III; maIs236. Show Description
maIs236 [mir-246p::GFP + unc-119(+)]. Wild type.
|
|
VT1665 |
C. elegans |
unc-119(ed3) III; maIs251. Show Description
maIs251 [mir-1p::GFP + unc-119(+)]. Wild type.
|
|
VT1673 |
C. elegans |
unc-119(ed3) III; maIs256. Show Description
maIs256 [mir-247-797p::GFP + unc-119(+)]. Wild type.
|
|
VT1702 |
C. elegans |
unc-119(ed3) III; maIs261. Show Description
maIs261 [mir-265p::GFP + unc-119(+)] Wild type.
|
|
VT1709 |
C. elegans |
unc-119(ed3) III; maIs267. Show Description
maIs267 [mir-266p::GFP + unc-119(+)]. Wild type.
|
|
VT1710 |
C. elegans |
unc-119(ed3) III; maIs268. Show Description
maIs268 [mir-259p::GFP + unc-119(+)]. Wild type.
|
|
VT1733 |
C. elegans |
unc-119(ed3) III; maIs276. Show Description
maIs276 [mir-60p::GFP + unc-119(+)]. Wild type.
|
|
VT1735 |
C. elegans |
unc-119(ed3) III; maIs278. Show Description
maIs278 [mir-788p::GFP + unc-119(+)]. Wild type.
|
|
VT1842 |
C. elegans |
unc-119(ed3) III; maIs300. Show Description
maIs300 [mir-82p::GFP + unc-119(+)]. Wild type.
|
|
VT2020 |
C. elegans |
unc-119(ed3) III; maIs347. Show Description
maIs347 [mir-793p::GFP + unc-119(+)]. Wild type.
|
|
VT2021 |
C. elegans |
unc-119(ed3) III; maIs348. Show Description
maIs348 [mir-794p::GFP + unc-119(+)]. Wild type.
|
|
VT2084 |
C. elegans |
unc-119(ed3) III; maIs352. Show Description
maIs352 [mir-71p::GFP + unc-119(+)]. Wild type.
|
|
VT2885 |
C. elegans |
cdc-42(gk388)/mIn1 [mIs14 dpy-10(e128)] II; mir-83(n4638) IV; mir-34(gk437) X. Show Description
Heterozygotes are superficially WT (DTC migration defects) with relatively dim pharyngeal GFP signal, and segregate superficially WT (DTC migration defects) with dim GFP, Dpy with bright GFP (mIn1 homozygotes), and non-GFP gk388 homozygotes. Pick WT dim GFP and check for correct segregation of progeny to maintain. Reference: Burke SL, Hammell M, Ambros V. Genetics. 2015 Jun 15.
|
|
VT3042 |
C. elegans |
nDf50 II; her-1(n695) V; nEx1187. Show Description
nEx1187 [mir-35 mir-45(genomic) + sur-5::GFP]. Pick GFP+ to maintain. Segregates GFP+ Egl animals carrying nEx1187 (mir-35 rescuing array) and GFP- animals that develop as XX pseudomales. Reference: McJunkin K, Ambros V. Genes Dev. 2017 Feb 15;31(4):422-437.
|
|
VT3077 |
C. elegans |
nDf50/mIn1 [mIs14 dpy-10(e128)] II; sup-26(n1091) III; her-1(n695) V. Show Description
Pick wild-type GFP+ to maintain. Heterozygotes are WT with GFP+ pharynx, and segregate Dpy GFP+ mIn1 homozygotes, and GFP- low viability non-Egl hermaphrodites. Viability of first generation nDf50 homozygotes (GFP-) segregated from balanced heterozygotes is rescued by maternal contribution of mir-35-41 from balancer. Second generation GFP- animals are low viability. Reference: McJunkin K, Ambros V. Genes Dev. 2017 Feb 15;31(4):422-437.
|
|
VT3118 |
C. elegans |
unc-119(ed3) III; mir-83(n4638) IV; mir-34(gk437) X; maEx246. Show Description
maEx246 (cdc-42p::GFP::H2B::cdc-42(mutated) 3`UTR + cdc-42p::mCherry::H2B::cdc-42 3`UTR + pBluescript + pIF9 unc-119(+) + pCFJ150 + pCFJ210). Pick non-Unc to maintain. Reference: Burke SL, Hammell M, Ambros V. Genetics. 2015 Jun 15.
|
|
VT3136 |
C. elegans |
unc-119(ed3) III; maEx246. Show Description
maEx246 (cdc-42p::GFP::H2B::cdc-42(mutated) 3`UTR + cdc-42p::mCherry::H2B::cdc-42 3`UTR + pBluescript + pIF9 unc-119(+) + pCFJ150 + pCFJ210). Pick non-Unc to maintain. Reference: Burke SL, Hammell M, Ambros V. Genetics. 2015 Jun 15.
|
|
VT3145 |
C. elegans |
unc-119(ed3) III; mir-83(n4638) IV; mir-34(gk437) X; maEx247. Show Description
maEx247 (pat-3p::GFP::H2B::pat-3(mutated) 3`UTR + pat-3p::mCherry::H2B::pat-3 3`UTR + pBluescript + pIF9 unc-119(+) + pCFJ150 + pCFJ210). Pick non-Unc to maintain. DTC migration defects. Reference: Burke SL, Hammell M, Ambros V. Genetics. 2015 Jun 15.
|
|
VT3178 |
C. elegans |
unc-119(ed3) III; maEx247. Show Description
maEx247 (pat-3p::GFP::H2B::pat-3(mutated) 3`UTR + pat-3p::mCherry::H2B::pat-3 3`UTR + pBluescript + pIF9 unc-119(+) + pCFJ150 + pCFJ210). Pick non-Unc to maintain. Reference: Burke SL, Hammell M, Ambros V. Genetics. 2015 Jun 15.
|
|
VT3297 |
C. elegans |
maIs105 V; mir-793(ma292) X. Show Description
maIs105 [col-19::GFP] V. mir-793(ma292) enhances retarded phenotypes of mir-48 mir-241 (nDF51). ma292 allele is missing the 220 nucleotide region between ACCGAGCAAGTTAGAAATCACCGCC and GTATGAATGTTTTTCCTTCAAACAT [chrX:13,857,855-13,858,124 of WBcel235/ce11].
|
|
VT3299 |
C. elegans |
mir-795(ma298) I; maIs105 V. Show Description
maIs105 [col-19::GFP] V. mir-795(ma298) enhances retarded phenotypes of mir-48 mir-241 (nDF51). ma298 allele is missing the 5 nucleotides between CCGAGAAACGTTACCTGCT and AGATTGATCAGCGAGCTTGA [chrI:12,594,565-12,594,608 of WBcel235/ce11].
|
|
VT3363 |
C. elegans |
nDf50/mIn1 [mIs14 dpy-10(e128)] II; nhl-2(ok818) III; her-1(n695) V. Show Description
Pick wild-type GFP+ to maintain. Heterozygotes are WT with GFP+ pharynx, and segregate Dpy GFP+ mIn1 homozygotes, and GFP- low viability non-Egl hermaphrodites. Viability of first generation nDf50 homozygotes (GFP-) segregated from balanced heterozygotes is rescued by maternal contribution of mir-35-41 from balancer. Second generation GFP- animals are low viability. Reference: McJunkin K, Ambros V. Genes Dev. 2017 Feb 15;31(4):422-437.
|
|
VT3500 |
C. elegans |
wIs51 V; hbl-1(ma354) X. Show Description
wIs51 [SCMp::GFP + unc-119(+)] V. GFP expression in seam cells. Gain-of-function allele causing retarded heterochronic defects including extra seam cells and absence of alae in young adult animals. ms354 is a 1120 bp deletion removing most of the hbl-1 3'UTR including all let-7-complementary sites. Sequences flanking the deletion: TTCTAATCATGGCCAGTTTCTTGCA and GTGCGTTCTTCTGTCATCATGTACA. Reference: Ilbay O & Ambros A. Development. 2019 Oct 9. pii: dev.183111. doi: 10.1242/dev.183111.
|
|
VT3554 |
C. elegans |
nhl-2(ma371[gfp::3xFLAG::nhl-2]) III. Show Description
Endogenous nhl-2 locus tagged at the N-terminus with GFP and 3xFLAG. Reference: McJunkin K & Ambros V. Genes Dev. 2017 Feb 15;31(4):422-437. PMID: 28279983
|
|
VT3593 |
C. elegans |
lin-46(ma385) maIs105 V. Show Description
maIs105 [col-19::GFP]. Retarded heterochronic phenotypes: extra seam cells and alae gaps in young adults. ma385 is a 1681 bp deletion of the lin-46 gene. Reference: Ilbay O & Ambros V. Development. 2019 Nov 6;146(21).
|
|
VT3727 |
C. elegans |
lin-28(ma426[lin-28::GFP]) I. Show Description
GFP reporter inserted into C-terminus of endogenous lin-28 locus. Superficially wild-type. Reference: Ilbay O, et al. C. elegans LIN-28 controls temporal cell-fate progression by regulating LIN-46 expression via the 5UTR of lin-46 mRNA. bioRxiv 697490; doi: https://doi.org/10.1101/697490.
|
|
VT3751 |
C. elegans |
maIs105 V; hbl-1(ma430[hbl-1::mScarlet-I]) X. Show Description
maIs105 [col-19::GFP] V. hbl-1(ma430) is a CRISPR/Cas9-edited allele, which contains a linker and the mScarlet-I sequence integrated in-frame with hbl-1. Reference: Ilbay O & Ambros V. Curr Biol. 2019 Jun 3;29(11):1735-1745.e4.
|
|
VT3855 |
C. elegans |
lin-46(ma467) maIs105 V. Show Description
maIs105 [col-19::GFP]. Precocious heterochronic phenotypes: fewer seam cells and protruding vulva in young adults and patches of alae in L4 larvae. ma467 is a 12 bp deletion in the 5'UTR of the lin-46 gene, which results in gain-of-function of lin-46. Reference: Ilbay O & Ambros V. Development. 2019 Nov 6;146(21).
|
|
VT3869 |
C. elegans |
wIs51 V; hbl-1(ma430ma475[hbl-1::mScarlet-I::partial deletion of hbl-1 3'UTR]) X Show Description
wIs51 [SCMp::GFP + unc-119(+)] V. GFP expression in seam cells. Retarded Heterochronic defects: extra seam cells and partial or no alae in young adults. hbl-1(ma430ma475) is a CRISPR/Cas9-edited allele, which contains a linker and the mScarlet-I sequence integrated in-frame with hbl-1 and part of the 3' UTR removed. Reference: Ilbay O & Ambros V. Development. 2019 Nov 6;146(21).
|
|
VT3922 |
C. elegans |
lin-28(n719) I; daf-12(ma497[daf-12::gfp]) hbl-1(ma430[hbl-1::mScarlet-I]) X. Show Description
Precocious heterochronic phenotypes as preciously reported for lin-28(n719). Endogenous daf-12 locus tagged with GFP. hbl-1(ma430) is a CRISPR/Cas9-edited allele, which contains a linker and the mScarlet-I sequence integrated in-frame with hbl-1. Reference: Ilbay O & Ambros V. Development. 2019 Nov 6;146(21).
|
|
VT3923 |
C. elegans |
maIs105 V; daf-12(ma498[daf-12::mScarlet-I]) X. Show Description
maIs105 [col-19p::GFP] V. mScarlet-I tag inserted at C-terminus of endogenous daf-12 locus through CRISPR/Cas9-engineering. Reference: Ilbay O & Ambros A. Development. 2019 Oct 9. pii: dev.183111. doi: 10.1242/dev.183111.
|
|
VT765 |
C. elegans |
unc-36(e251) III; maIs103. Show Description
maIs103 [rnr::GFP + unc-36(+)].
|
|
VT774 |
C. elegans |
unc-36(e251) III; maIs103. Show Description
maIs103[rnr::GFP + unc-36(+)]. Non-Unc. nrn::GFP is expressed in S phase cells.
|
|
VT825 |
C. elegans |
dpy-20(e1282) IV; maIs113. Show Description
maIs113 [cki-1::GFP + dpy-20(+)]. Non-Dpy. cki-1::GFP is expressed in all arresting cells that have exited cell cycle.
|
|
VZ119 |
C. elegans |
vzEx32. Show Description
vzEx32 [trx-3p::GFP + rol-6(su1006)]. Rollers. Pick Rollers to maintain. GFP expression in intestine. Reference: Jiménez-Hidalgo M, et al. Free Radic Biol Med. (2014) 68:205-219.
|
|
VZ132 |
C. elegans |
vzEx36. Show Description
vzEx36 [trx-3p::trx-3::GFP + rol-6(su1006)]. Pick Rollers to maintain. trx-3 translational GFP fusion. GFP expression in intestine. Reference: Jiménez-Hidalgo M, et al. Free Radic Biol Med. (2014) 68:205-219.
|
|