More Fields
Strain Species Genotype
VC4570 C. elegans F26H11.8(gk5641[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) II. Show Description
Homozygous viable. Deletion of 537 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: AACCATAAATATAATCGAATCAAAATTCCT. Right flanking sequence: TCTTCGTCGTCGTCCTCGTCTTCCTCATCA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4571 C. elegans F33D4.6(gk5642[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) IV. Show Description
Homozygous viable. Deletion of 3735 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: AGAAAATTGCACAAAAGTCAAGGGCAGAAA. Right flanking sequence: AAGAGATGTCTCATCTGAAACATACATTTA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4572 C. elegans ccch-2(gk5643[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) IV. Show Description
Homozygous viable. Deletion of 922 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: ATATGTACCAGTAAATGGGCGGAGCCTAAC. Right flanking sequence: CTAGCACTGACTTCTCTTAACTTTATTCTT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4573 C. elegans sucl-2(gk5644[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) III. Show Description
Homozygous viable. Deletion of 1315 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: ATAGAAAATAGAATTAGACACAAAAGCTGA. Right flanking sequence: CGGGGCACTCAAGTGAATGAAATTGACTAT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4574 C. elegans rfc-4(gk5645[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ III. Show Description
Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 1735 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: ATGTACCGTACACCATTTCAAACACTCTCG. Right flanking sequence: GTCGCCCATCGATTTTCGCTCCTTGAAGAC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4575 C. elegans F26E4.4(gk5646[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ I. Show Description
[NOTE: Please see RG5025 for balanced version of this strain.] Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 1524 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: CAAAAAAACTGGATAACAATAAATTGGCAA. Right flanking sequence: TGGAAAACGCACGCGACGCGTGACCGCAGC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4576 C. elegans maph-1.1(gk5647[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) I. Show Description
Homozygous viable. Deletion of 4814 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: GTTATTCATTTTGATATGTGTCTCTAGGCA. Right flanking sequence: GAATGCTCTTCAAAATCACTATTTTTAATG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4577 C. elegans idhg-1(gk5648[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ III. Show Description
[NOTE: Please see RG5056 for balanced version of this strain.] Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 2420 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: GAAACACGTGCGGCGCTTGCAAATCAATCG. Right flanking sequence: TTACGTTCTTTTCCTCTGTTTTTTTTTCGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4578 C. elegans prx-12(gk5649[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ X. Show Description
Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 1339 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: GATACGGACAGTGTCCTCGCTCCTCCGGCA. Right flanking sequence: ACAGGATGCCCGGCAAACGTTCAGCATTTA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4579 C. elegans rpb-8(gk5650[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ III. Show Description
Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 782 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: TCATGAGAAGGTACAGATTCATGTCGACCT. Right flanking sequence: GGGATATCTAAAAATGGGAGATGAGCGAAT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4580 C. elegans F25G6.9(gk5651[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) V. Show Description
Homozygous viable. Deletion of 4606 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TGTAACCGAACAAAATAGGAGACACCAGTC. Right flanking sequence: CGCGGGTTCCACGGGATTCATGTCGAAAAT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4582 C. elegans atp-3(gk5653[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ I. Show Description
Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 1382 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: CTGTTTTCTTTCAAAACATTATTAAGAAGT. Right flanking sequence: TGGCTGAGTATCACTCTCTTAACCATAAGC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4583 C. elegans F32E10.5(gk5654[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) IV. Show Description
Homozygous viable. Deletion of 1347 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TTGTAGAACTCGTTTTTTTTTTCTGCTCCA. Right flanking sequence: CCATAATCCCATCCAGCATCCTCTTCTTCT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4584 C. elegans rpt-3(gk5655[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ III. Show Description
Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 1611 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: GAAATAAAAGTAAGTTGAAACCACATCGTA. Right flanking sequence: ATTTCGAGTTCTACAAGTAAACCACGAGTT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4586 C. elegans arp-11(gk5656[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ IV. Show Description
Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 2105 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: ATCAGCAGCTAATTTTCCATTTTTCCACTC. Right flanking sequence: TCAGCGACTCCAACGTTGATTGAGCAGTTG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4588 C. elegans F33H1.3(gk5658[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) II. Show Description
Homozygous viable. Deletion of 1872 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TGGACTATTGATAGTGTTTTGTGGTGCGTT. Right flanking sequence: GAGAAACGAGAGAGGCATCCGAGTCTCCCA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4589 C. elegans srpa-72(gk5659[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ II. Show Description
Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 6397 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: AAGATGTGAGCATTCGGGTACGCAATTTGT. Right flanking sequence: ATTGGCGATTTTTAAGCCTTTTTGTCTGAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4590 C. elegans nspb-4(gk5660[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) IV. Show Description
Homozygous viable. Deletion of 1450 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: CCTACGTGCTTACCAACATATCTGCCTAAC. Right flanking sequence: AGCGGTAACTTTTCAATTTTCCAATCACTT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4591 C. elegans grd-5(gk5661[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) V. Show Description
Homozygous viable. Deletion of 512 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: ATATAAAGCACCTCGCATTGTCAACCTCCT. Right flanking sequence: GATCTCTCGGAGGAAAATTCGAGACTGTCG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4592 C. elegans algn-2(gk5662[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ II. Show Description
Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 2125 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: TCAATATAGTAGATCGCATTGTTTCCAAGA. Right flanking sequence: AGGCACACACTCGTTTGTACTTAAGAAAAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4593 C. elegans F27D4.1(gk5663[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ I. Show Description
Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 2223 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: ATTTAAATTAATTTTGGCAATTTCTACCCG. Right flanking sequence: CATGAATACCTTCAAATAGCCTAATGTAGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4595 C. elegans cdc-73(gk5665[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) IV. Show Description
Homozygous viable. Deletion of 4854 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: TCTCGTGGCCGCGGCCTAGAAATCCCGCTC. Right flanking sequence: CCAGGATAAGCCGGTGGCTCAAGTGATGCA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4596 C. elegans dxbp-1(gk5666[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ I. Show Description
[NOTE: Please see RG5003 for balanced version of this strain.] Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 2234 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: GGTGGGCGGCAAAATATTTTTTCCGCCAAACCGGCAAATTGCCGGAATTGAAAATTTCCG. Right flanking sequence: TTCGGAAGTTAAGTGGCATTTGAAGCCGTT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4597 C. elegans F32D1.7(gk5667[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) V. Show Description
Homozygous viable. Deletion of 1527 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TTTATATATACACGAATGTCATTTAGTCGG. Right flanking sequence: CCTGGCACGGCAAAACAAAATTAGCAATTG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4598 C. elegans F25H5.10(gk5668[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) I. Show Description
Homozygous viable. Deletion of 369 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: ACGACTTTCATGGGTGACAGATTTTAGAGC. Right flanking sequence: AATTGGCGAAGAAAAGAAAGTGAAATTTTG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4599 C. elegans K04F10.3(gk5669[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ I. Show Description
Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 1711 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: AAAGGAGTTGTGTTAGCGCACTCTCCGTGC. Right flanking sequence: GTGTCTTTCTGCCTGTCACATTTACTTGTA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC460 C. elegans unc-60(gk239) V/nT1 [qIs51] (IV;V). Show Description
C38C3.5. Homozygous lethal deletion balanced by GFP-marked balancer. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1 aneuploid progeny, and non-GFP gk239 homozygotes (early larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP hermaphrodites and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC4600 C. elegans F32B6.3(gk5670[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ IV. Show Description
Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 2258 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: TTAACAAATTCGACACTTTTCGATGGATCC. Right flanking sequence: CCGCTTTCTGCTCTTTTTCTTGATATCTTT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4601 C. elegans F30A10.13(gk5671[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) I. Show Description
Homozygous viable. Deletion of 642 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: AACTTGGAGAAGAAGTTGCCGGGAAATGTC. Right flanking sequence: AGGAATTTTTGTGCGTTCAAGACTTTATGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4602 C. elegans F39G3.5(gk5672[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) V. Show Description
Homozygous viable. Deletion of 3027 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: TCCAATAAATAACATTTGTACCGGCCATAA. Right flanking sequence: TTGGCTCTTTTATTAGGTGTTTGTACCAAG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4603 C. elegans pbs-1(gk5673[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ IV. Show Description
Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 783 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: AAACGATTTTAGAGGACTTGTTCGATGTGC. Right flanking sequence: TGGCTTTGCGCTTCTCATCTCGCATAGTAT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4604 C. elegans F42C5.6(gk5674[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) IV. Show Description
Homozygous viable. Deletion of 982 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: CAGCTAGTTGACGAACACGATCCGCTGCTG. Right flanking sequence: GGGGGATCGCGATTAGATGTTGTTGGGGTA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4605 C. elegans tni-1(gk5675[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ X. Show Description
Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 1397 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: TAATGACAACAATGCCGGTATTTATTCCTC. Right flanking sequence: GGTGGGTGTGAAGGTATTCAAGGGTGTGTG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4606 C. elegans F56D5.2(gk5676[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ IV. Show Description
Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 2308 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: TACAGTGGAAAATATTTCAGGACACCACGG. Right flanking sequence: ATTGGTTCAAAAGTGGCGGTACGAGTCGCT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4607 C. elegans F59B10.3(gk5677[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ II. Show Description
[NOTE: Please see RG5016 for balanced version of this strain.] Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 2307 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: GAGAAGAGGCGGAGGATTGCGGCGATATGT. Right flanking sequence: CGATTTTCTGTAAATATTTGCTCAAACCTT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4608 C. elegans exos-7(gk5678[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ V. Show Description
Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 2617 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: ACAAAATCATTTTTCAAAATATATCTTCCT. Right flanking sequence: AATTTATGGAATTTATTCAATTTGTTGATT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4609 C. elegans F30F8.9(gk5679[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) I. Show Description
Homozygous viable. Deletion of 3227 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: TATTCCTGACACAATTATTTCAATTATCCA. Right flanking sequence: GTTAAGTACTTTTTCCCCATCCGCTCCAGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4610 C. elegans H12I13.1(gk5680[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) II. Show Description
Homozygous viable. Deletion of 5113 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TTTATTTACATTAAAATGAACTAACCTCCA. Right flanking sequence: CTGGCTTAGAATCTCAAGCGACTGTAGTAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4611 C. elegans F32D1.5(gk5681[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) V. Show Description
Homozygous viable. Deletion of 1829 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: GTGTAGGTGCAAGCTGAACGGATGCCTCCG. Right flanking sequence: TGGGGCAGCGCTATCAATTCAAAAAAAAGC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4612 C. elegans C34D4.4(gk5682[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ IV. Show Description
Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Pick viable fertile GFP+ animals to maintain. Deletion of 1040 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: AAAAGCGAAAATTTCCGGAGCGTTCCCCCG. Right flanking sequence: TGCTCAACAACCACCACAAGAATATCAAAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4613 C. elegans F09E5.11(gk5683[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ II. Show Description
Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 655 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: CCATATTCTTGAAGCTGAATGTTTCCCCAG. Right flanking sequence: GTAGGAGATTTTTATCTTCTTGTGACACGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4614 C. elegans F35G12.7(gk5684[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) III. Show Description
Homozygous viable. Deletion of 527 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: GAATTCGTAGAATCCACAATCCATCCTCCA. Right flanking sequence: TATGGGTCGCACTTGCGCGTCACGGTGTTT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4615 C. elegans ucr-11(gk5685[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) I. Show Description
Homozygous viable. Deletion of 448 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: AACATCTTCATAATTCTAAAAAAGTCAATC. Right flanking sequence: TGGCTTCATGTACAGCATGATTCAACCTGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4619 C. elegans F37C4.4(gk5689[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ IV. Show Description
Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 2273 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: ATTCCGATAATTTGTTGTACTTTCACGAGT. Right flanking sequence: ATCCAGAAGATAAGGGTTATCATATCGTGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4620 C. elegans vha-10(gk5690[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ I. Show Description
Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 714 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: GGAGAGGGATATCACATCATAAAAGTAAGG. Right flanking sequence: GTTTGTGAGGCCATTTTAAGGTTTTCGGTA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4621 C. elegans F44B9.8(gk5691[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ III. Show Description
Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 977 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: TCATTTCGTGAAAAATAGGAATCACCGAGA. Right flanking sequence: GGGGAATACATTTGTCGCGCTGCTGCTAAC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4622 C. elegans rpb-4(gk5692[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ II. Show Description
Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 620 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: TCTAAAAAATATTTTTAGAAAATGTCTTCC. Right flanking sequence: AGATCTCTCATAATGTGTTATTTGATACAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4623 C. elegans tnc-2(gk5693[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ II. Show Description
[NOTE: Please see RG5017 for balanced version of this strain.] Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 2787 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: CAGTTTAGTCGGTTTTTCTGATATCCAGGT. Right flanking sequence: CATTCACTGACTTCCAATAATTCTTTTTGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4624 C. elegans F35H10.5(gk5694[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) IV. Show Description
Homozygous viable. Deletion of 451 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: AATCATGGTAATGCACATCAAACAGTCTAC. Right flanking sequence: CGTGTCACACAATCATTTCAATCGGAGTTT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4625 C. elegans F44A2.3(gk5695[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) V. Show Description
Homozygous viable. Deletion of 5155 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TTTTTCTCGGCATTTTTTGGTTTACCGTCT. Right flanking sequence: GTCTCACTTCTTCCAAATGCTCTGCTTCTG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.